Entry information : AtPrx68 (At5g58400 / PER68 / AtperoxP68)
Entry ID 234
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: AtPrx68 (At5g58400 / PER68 / AtperoxP68)
Name (synonym) AtPrx68 (At5g58400 / PER68 / AtperoxP68)
Class Class III peroxidase    [Orthogroup: Prx055]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Flowers
Siliques
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx68
start..stop
S start..stop
TsPrx67 503 0 26..325 27..326
BrPrx68-1Aa_other 497 2e-179 5..325 2..324
BrPrx67-1Aa_other 493 6e-178 14..325 5..316
CagraPrx29 480 2e-172 4..325 3..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23606743..23606967 225 N° 2 23606412..23606603 192 N° 3 23605357..23605917 561  
complement(join(23605357..23605917,23606412..23606603,23606743..23606967))


exon

Literature and cross-references AtPrx68 (At5g58400 / PER68 / AtperoxP68)
Protein ref. UniProtKB:   Q9LVL1
DNA ref. Phytozome 12:   Chr5 (23606967..23605357)
mRNA ref. GenBank:   NM_125226
Cluster/Prediction ref. Phytozome Gene 12:   19665579 UniGene:   At.29282
Omic ref. AtProteome:   At5g58400 ATTED-II:   At5g58400 e-FP Browser:   At5g58400 ePlant:   At5g58400 Genevestigator:   At5g58400 TAIR:   At5g58400
Protein sequence: AtPrx68 (At5g58400 / PER68 / AtperoxP68)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (297)
PWM (Da):   %s   35490.1 (32320.5) Transmb domain:   %s   i12-29o
PI (pH):   %s   9.54 (9.77) Peptide Signal:   %s   cut: 29 range:29-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MECYEQSRQRAAFVVLLFIVMLGSQAQAQLRTDFYSDSCPSLLPTVRRVVQREVAKERRIAASLLRLFFHDCFVNGCDASILLDDTRSFLGEKTAGPNNNSVRGYEVIDAIKSRVERLCPGVVSCADILAITARDSVLLMGGRGWSVKLGRRDSITASFSTANSGVLPPPTSTLDNLINLFRANGLSPRDMVALSGAHTIGQARCVTFRSRIYNSTNIDLSFALSRRRSCPAATGSGDNNAAILDLRTPEKFDGSYFMQLVNHRGLLTSDQVLFNGGSTDSIVVSYSRSVQAFYRDFVAAMIKMGDISPLTGSNGQIRRSCRRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2), 3 cDNA and 2 ESTs
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATATAGAAT TATTTTCTTG AAGAACTGTC GTATAGTTAT CATCTTTCTT TCTTTTTTGG TATCAACTAT AATTATTATC TTTCATCAAC AACAACAACA AAAACTCTAT ATAGAGAGGT  TCACGAAAAG AAAAAGTTAT TCCTAAAAAG CGGACATAGC AAAATTACAA GATTTAACAA AAACAAATAC AATATTTGTG GTTCAGTTTT CAACAATCCA CGTGAATAAT TAAATATGTA  CGTTTTCTTA TATTTTTGAA GAGGATGATT GTAGATTAGG GTTACTGTGG GTGATAGACA ATTCGATCGA ATAATAGTAT GTTCTGTTAA CTACCTCTCA CTATCGCTTT AAAATAAACG  AAAAGAAGAA AGAAAAAAAA CTTTGTCTCC CAATTTTGAA ATTCAACTTC TTATGCAAGC CACACACTAA TTATCCCATG TGACTTAGTC GGAAATCTAA GGCGTGTTTA TTTAGTTTTG  AATACGTAGA TCAGCTATCA ACGATACTCT TTAGGGTTTT GGCGTTCTAG ACTTCTAGTT CTCATCCAAT TAAAATTTGA ACAGCATGTC ATATAGTTGC CCTTGCCCCA TATTCCATGA  CCAGTATTTT TTTTCTTCTT TGTGTGGGTG TGCGTAGCGG ATAAAACTTA TACTAGCTTA CAATAATTAA TTAAAGTCAG AGCACAAAAT CGTTAATTAG GTTAAATATT ACTAGCGATT  CTAACGGATA AAATCATTTA AGGTGGTGTT TAAGCCTCTT TTCTGTATAT ATAATATATG TGTTTGGTAA GTATAATAGC AATAACAAAA AATTTGCAGG AGTAAACTAG TTGTGAACAT  GATTTATTTG AAAAATAAAC AAACTAATCT TAGGGGTACG CTTTCTTTTG AAAATATATA AAACTTCATG AAAGTGGAAA TTGAAAGGTG AGAAAGACTG ATATTTATGA GAATGTCGTT  GGTGGTTGCA TGCATTGATA GGTAAGCTGT TTCTACCTAT CTCATCCTCC CCAATTATAC GATCATCACT AGCTCTGCCC ACACTCTCTC GATCATTTCC TTTCGTGTTC ACAAATTATT  TGAAGGGAAA TAATTAAACG AAGTTGGAAG ATACCAATGT CAAAAACCGA GATCGATCGG AATCCCTCAC TGACATGAAG ACTGTATAAG GATCTGGAAT ATATTTTAGA ATGTGTTATT  ATGTCTTTAA TATTTTGGTC AAAGATGTGT CTGTCTTAAT TTAGAATTCT TTACGTTTAT ATAAAGATAG TGCATGAATA TATTTAAAAG TGCAACACAT TTTTTAAAAA AAAAATCAAG  TGTAACACAT TTATTTCATA TAATGTGTTA TGTTATTAAA TATTAGTATC ATCAACTTAT CATGGATTCA TATAACCAAT ACACGTCAGC CAAACCTATT AGGCTATTAC ATATCATGGT  ATTATATTGA TATTAATTTA GATGTTTTAT GTTCCCATCA GTCATCGACT TATCATATAG TATCAAAATT TGATCTATAA CACAAGCCCC AAAATTGGAC GTCGCTTCTC TTTATATTAC  GGTAGATACC ATTTTTATTT ACGATGTACG CTTCATATAC CTTAAATTAA TAACGTATAT ATTATATATA TGTATATAGC AATGTTGATA CGGCTATTGA CATGCATATA ATAAAGTATG  GGCAGATAAA AACGTGTGTT ATATCTATTG ATAGAACTAG CTTAGCTTTA CGAGGACTAG AGACTAGAGA GTAGAGAGTT TAACTTTTAT ATAGATGATA AACAACAAAA ATGTTCTTAA  AGAAAAGGAA AACGCGAACA ATAATGTGGT AGTCTGGTAG AGCCGTAGAG GTGACGTGAG GATTTTGGCA CAGTAAATAA AAAAACACCT ACGTGGAAGT AAACCTCTAT AAAAGCAATC 
AGCCTCGGGA TTGCTTCTTG ATCCCTCGTA ACTCCTATAG AAAAACAGAA GTAAAACAAA AATAAAATAA AAACACAAAG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATAGTCTCT ACTATTAAGC CCATAATAAT CTCTTAGTGA ACTGTTTTTT TCTTATTTTA ATGTGCATCA TTCTGATGTT ATTGCGATAT GTCAATTAAT TAAACCGGAA ATATCTATTG  TTTAATCGAT ATAATATATA ATATAATTAA GTAACAGATC AATAGAGGTA AACGAGTTTA ATCGTATTCA CTATTCAATT TAAATTTCGC CGAGATTTGA GTTCTTTTGA CGAATGTTCT  CTCCCAATCT AATATCTATT GTTCTCCTAA ACCATAATAT TCCATGTTAC CCATATCTAT GAGATATGGC TCAACCTCTC AAGTCACCCA TTTCGCTTAT TTAAGGCCCA TTTGTTTATG  GCCCAATAAG AGGAAGGGCC CCTTTTATAA AAATTCACAA AAAGTTCCTC TATATATTAG TTTGTTTATT ATCAGCCCAC GATTTTTGTA AATTCGATAA TTTGACTAGA TGAGCTAGTA  TGATCATTGA CCACCATACG ACTTGTGTAA CTGTGTTATT CCGTAGTCAT ATTATATATC ACCATTTCTT ACAAGATTCT ATCATATATA CAAAATTACA TATTATAGTC TACCGTAAAA  TGTAAATGAC CATTCATTAT TCACGACGGA CTATTTTATA TATTGTTAAC AAATGAATCA CCTAATTTTC TAGAAAGAGT ACGATACAAT GACGAACCAC ATTCATAATC AACAATAATT  TACCTTTTGT ATCTCCACAT AAATTGATCA TCGTAACTCT TATTTTTTGT CGATCTATGT TTAACTGTTG AAGTTCATGA TAGGACTCAT GAAAGCCGTG AATTATAAAT TAATGTGTAA  ATTTTGTTTT AAAGAGACAT ATGCATTCTT ACTATATAGT ATATACACAC ATCACACTTG AATAATAAAT GTATAGTGTT TTTATTTGAC AAAGGAAAAA AATGTATAGT GTTTAAATTA 
AACATTTGAA ATTCTCAAAT AATTGTGCTT TTGATGGTCT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGCTATGAGCAGAGTCGTCAGAGAGCTGCGTTCGTTGTGCTGTTGTTTATCGTTATGTTGGGATCCCAGGCACAGGCCCAACTACGCACTGACTTCTATTCGGACAGCTGTCCA
TCACTGCTCCCTACGGTGAGGCGGGTGGTGCAGCGAGAGGTGGCCAAAGAGCGTCGGATAGCTGCTTCCCTCCTCCGACTATTCTTCCATGATTGCTTCGTCAAC
GTAGGTCTTCTTTTC
GTTTTTTTTTTTTATATATTGTTTTTTTGTTAATAAAAGAAAGGAAGCGTACGCTTGCCATGTCTACATGTATTTTCGTTAATTAGAATGCTAACATTGTTGTAAACTGAAACAAAAATG
GCAGGGCTGTGATGCGTCAATATTATTGGATGATACACGTTCATTCCTCGGAGAAAAGACGGCTGGACCTAACAATAATTCCGTTCGAGGATATGAAGTCATCGACGCAATCAAATCAAG
GGTTGAGAGACTCTGCCCAGGCGTGGTGTCATGCGCTGACATCCTGGCAATCACGGCTCGGGACTCGGTCCTTCTA
GTTAGTACCTCTCTCTGCCCGTACTCTTTTACATATAAATATAT
ATATGGCCATTTATTTTAACTTGCGCAAGTGGAACTTTTGAATATCTCTGATTTTCATTTGTAAAACTATTTCAAGAGTAATTTATGCAAATTTGGCCCTTAATTTTATTTTCAGAAAGT
TTTAATACATCAACTTCTGTTTAACGATTTTTTACACATGGTCTTCAAATAGTTTGAACGGTCAAGCTCTCGTGTACGTGTACCACTATTTGGTCTTGCCACTGGATCGTTGCGGGTTTT
CAAATTTTAGAAATTTTCAATTAGGTAGAAAATATTTTACATTCGTATCACATTATTGTTTGACAGATTCGTATATAGTGTATGCAAACCTATATCTTCAATCCATATATGATCTTACTT
ACATCTTTTTTTTTTGGACGACGATTTGTGACTAAAATTTTGAAGAATTGTTTTGTAAAGAATCTTACTTACACCTTTTGAACTAAGCAGATGGGTGGCCGCGGCTGGAGCGTAAAACTA
GGGAGACGTGATTCTATCACGGCGAGCTTCTCCACTGCTAACTCCGGCGTCCTGCCACCTCCAACCTCTACTCTTGATAACCTTATTAACCTTTTCCGAGCAAACGGTTTATCCCCACGC
GACATGGTGGCGCTCTCCGGGGCTCACACCATTGGGCAAGCCAGGTGCGTCACCTTCAGGAGCCGGATATATAACTCAACAAACATCGACCTTTCATTTGCCTTATCCAGACGGAGGAGC
TGCCCTGCGGCAACTGGCTCCGGCGATAACAACGCCGCCATTCTCGATCTCCGCACACCTGAAAAGTTCGACGGCAGCTACTTCATGCAGCTTGTCAACCACAGGGGACTTCTCACATCA
GATCAGGTCTTGTTCAACGGAGGTTCCACCGACTCGATCGTCGTATCCTACAGCCGGAGTGTCCAAGCATTCTACAGAGATTTTGTAGCGGCGATGATAAAAATGGGCGACATCAGCCCA
CTCACCGGGTCCAATGGACAGATCCGTCGCAGCTGTCGCAGGCCCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGCTATGAGCAGAGTCGTCAGAGAGCTGCGTTCGTTGTGCTGTTGTTTATCGTTATGTTGGGATCCCAGGCACAGGCCCAACTACGCACTGACTTCTATTCGGACAGCTGTCCA
TCACTGCTCCCTACGGTGAGGCGGGTGGTGCAGCGAGAGGTGGCCAAAGAGCGTCGGATAGCTGCTTCCCTCCTCCGACTATTCTTCCATGATTGCTTCGTCAAC
GGCTGTGATGCGTCA
ATATTATTGGATGATACACGTTCATTCCTCGGAGAAAAGACGGCTGGACCTAACAATAATTCCGTTCGAGGATATGAAGTCATCGACGCAATCAAATCAAGGGTTGAGAGACTCTGCCCA
GGCGTGGTGTCATGCGCTGACATCCTGGCAATCACGGCTCGGGACTCGGTCCTTCTA
ATGGGTGGCCGCGGCTGGAGCGTAAAACTAGGGAGACGTGATTCTATCACGGCGAGCTTCTCC
ACTGCTAACTCCGGCGTCCTGCCACCTCCAACCTCTACTCTTGATAACCTTATTAACCTTTTCCGAGCAAACGGTTTATCCCCACGCGACATGGTGGCGCTCTCCGGGGCTCACACCATT
GGGCAAGCCAGGTGCGTCACCTTCAGGAGCCGGATATATAACTCAACAAACATCGACCTTTCATTTGCCTTATCCAGACGGAGGAGCTGCCCTGCGGCAACTGGCTCCGGCGATAACAAC
GCCGCCATTCTCGATCTCCGCACACCTGAAAAGTTCGACGGCAGCTACTTCATGCAGCTTGTCAACCACAGGGGACTTCTCACATCAGATCAGGTCTTGTTCAACGGAGGTTCCACCGAC
TCGATCGTCGTATCCTACAGCCGGAGTGTCCAAGCATTCTACAGAGATTTTGTAGCGGCGATGATAAAAATGGGCGACATCAGCCCACTCACCGGGTCCAATGGACAGATCCGTCGCAGC
TGTCGCAGGCCCAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATCCCTCGT AACTCCTATA GAAAAACAGA AGTAAAACAA AAATAAAATA AAAACACAAA GATGGAGTGC TATGAGCAGA GTCGTCAGAG AGCTGCGTTC GTTGTGCTGT TGTTTATCGT  TATGTTGGGA TCCCAGGCAC AGGCCCAACT ACGCACTGAC TTCTATTCGG ACAGCTGTCC ATCACTGCTC CCTACGGTGA GGCGGGTGGT GCAGCGAGAG GTGGCCAAAG AGCGTCGGAT  AGCTGCTTCC CTCCTCCGAC TATTCTTCCA TGATTGCTTC GTCAACGGCT GTGATGCGTC AATATTATTG GATGATACAC GTTCATTCCT CGGAGAAAAG ACGGCTGGAC CTAACAATAA  TTCCGTTCGA GGATATGAAG TCATCGACGC AATCAAATCA AGGGTTGAGA GACTCTGCCC AGGCGTGGTG TCATGCGCTG ACATCCTGGC AATCACGGCT CGGGACTCGG TCCTTCTAAT  GGGTGGCCGC GGCTGGAGCG TAAAACTAGG GAGACGTGAT TCTATCACGG CGAGCTTCTC CACTGCTAAC TCCGGCGTCC TGCCACCTCC AACCTCTACT CTTGATAACC TTATTAACCT  TTTCCGAGCA AACGGTTTAT CCCCACGCGA CATGGTGGCG CTCTCCGGGG CTCACACCAT TGGGCAAGCC AGGTGCGTCA CCTTCAGGAG CCGGATATAT AACTCAACAA ACATCGACCT  TTCATTTGCC TTATCCAGAC GGAGGAGCTG CCCTGCGGCA ACTGGCTCCG GCGATAACAA CGCCGCCATT CTCGATCTCC GCACACCTGA AAAGTTCGAC GGCAGCTACT TCATGCAGCT  TGTCAACCAC AGGGGACTTC TCACATCAGA TCAGGTCTTG TTCAACGGAG GTTCCACCGA CTCGATCGTC GTATCCTACA GCCGGAGTGT CCAAGCATTC TACAGAGATT TTGTAGCGGC  GATGATAAAA ATGGGCGACA TCAGCCCACT CACCGGGTCC AATGGACAGA TCCGTCGCAG CTGTCGCAGG CCCAACTAAA ATAGTCTCTA CTATTAAGCC CATAATAATC TCTTAGTGAA 
CTGTTTTTTT CTTATTTTAA TGTGCATCAT TCTGATGTTA TTGCGATATG TCAATTAATT AAACCGGAAA TATCTATTGT TTAATCGATA TAATATATAA TATAATTAAG TAAC 

Retrieve as FASTA