Entry information : CnCcP01_JEC21 (CcP1)
Entry ID 2357
Creation 2006-08-30 (Nenad Bakalovic)
Last sequence changes 2006-08-30 (Nenad Bakalovic)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: CnCcP01_JEC21 (CcP1)
Name (synonym) CnCcP01_JEC21 (CcP1)
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnCcP01_JEC21
start..stop
S start..stop
CnCcP01_grubiiH99 743 0 1..377 1..377
CgaCcP 677 0 1..377 1..377
CgaCcP01_R265 667 0 1..377 1..376
TmesCcP01 595 0 1..376 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 716307..716426 120 N° 2 716001..716253 253 N° 3 715798..715937 140 N° 4 715518..715747 230
N° 5 715402..715463 62 N° 6 715252..715351 100 N° 7 715142..715195 54 N° 8 714990..715073 84
N° 9 714845..714935 91  
complement(join(714845..714935,714990..715073,715142..715195,715252..715351,7154 02..715463,715518..715747,715798..715937,716001..716253,716307..716426))


exon

Literature and cross-references CnCcP01_JEC21 (CcP1)
Literature Fung,E. et al., Cryptococcus neoformans serotype D sequencing, unpublished
Protein ref. UniProtKB:   Q5KIK5
DNA ref. JGI genome:   NC_006686 (716426..714845)
Cluster/Prediction ref. UniGene:   Fne.3348
Protein sequence: CnCcP01_JEC21 (CcP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377
PWM (Da):   %s   41970.97  
PI (pH):   %s   9.3
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFRAPNLIRSAAGRRASQTLNLRSQVIRRRFATEGGPEITKPSSPRSSNTRYLLAGVGIAAVGAAYYFYGTGRTAHDSANKADTVVRGAVATVEAKTGLRRGKDEYQKVYNRIAETLEKEGYDDGSLAPVLLRLAWHSSGTYNKEDGTGGSNFATMRFKPEAEHSANNGHVAREHMEKIKQEFPWISYGDLWTLGGVCAVQESGGPTIPWRPGRIDGFEAQVTPDGRLPDASQAQDHLRFIFNRMGFNDQEIVALSGAHAMGRCHNRSGFEGPWTFSPVTFSNQYFALLRDEPWQWKKWTGPAQYEDKNTKTLMMLPTDMALLKDKSFKKYVDIYADNEEKFFSDFAKAFSKLIELGVPERQWAGEPWTLGTSD

Retrieve as FASTA  
Remarks Complete sequence genomic (Chromo 4, 8 introns) and ESTs. Strain="B-3501A" (NC_009180.1), strain="JEC21" (NC_006686).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAGAGCTCCCAATTTGATACGATCAGCCGCTGGCCGAAGAGCCAGTCAAACTTTGAACCTGCGTTCTCAAGTTATTCGACGACGATTTGCAACTGAGGGTGGACCGGAGATT
GTAAGCAGCTTCATCAGCCATGTTGACTACGATATTTTACTGAACAGACGCAGACCAAACCATCTTCTCCACGATCTTCGAACACTCGTTATCTCCTCGCAGGTGTCGGTATCGCTGCCG
TCGGCGCTGCATACTATTTCTACGGCACTGGCAGAACCGCGCACGATTCCGCCAATAAAGCTGACACGGTAGTGCGTGGAGCTGTTGCCACGGTTGAGGCCAAGACGGGTCTCCGAAGAG
GCAAGGACGAGTATCAAAAAGTCTATAATCGGATTGCCGAGACTCTCGAGAAGGAGGGTTACGACG
GTTAGTTTTCAATTACTTGCTGAATGCGGTAACGAAGCATACGGTGGCTGATAA
GAATATCAGACGGTTCTTTGGCCCCCGTCCTTCTTCGCTTGGCTTGGCACTCCTCTGGCACCTATAACAAAGAGGATGGTACTGGAGGATCGAACTTTGCTACCATGAGGTTCAAGCCCG
AGGCCGAGCACAGCGCGAACAATGGCCTA
GTGGGTGTTGATCCAACTGGACATATATTCTTGGGCTGATCATATCATAGCATGTTGCCAGGGAACATATGGAAAAGATCAAGCAAGAGTT
CCCCTGGATCTCTTACGGTGACCTATGGACCCTCGGTGGAGTCTGTGCTGTCCAGGAGTCGGGCGGACCTACCATCCCTTGGAGGCCTGGCAGAATTGACGGCTTCGAAGCTCAAGTCAC
TCCCGATGGTAGGCTACCGGATGCCTCTCAAGCCCAAGACCATCTGAGGTTCATCTTTAACCGCATGGG
GTGAGTCGCCAGGTTTACTGAAAAAGACTAGGAAAACTTACGGCATTGCAA
TAGCTTCAATGACCAAGAAATTGTTGCCCTTAGCGGCGCTCATGCCATGGGGCGATGTCATACTAGTGAGTTCTTTTTTTAGTAATCAACATGAAACGTCTGACCGGATCTTTAGATCGA
TCGGGCTTTGAGGGCCCTTGGACTTTCTCCCCTGTCACCTTTTCCAACCAGTACTTTGCTCTTCTCCGAGACGAGCCTTGGCAGTGGAAGAAGTG
GTGAGTACTCTATGACATCACCTGA
AATGATCAGTCGCCTCATCCTGGTATTACAGGACCGGACCTGCCCAATATGAAGACAAAAACACAAAGACCTTGATGATGCTTCCGTAAGTTCTGAGATCAGAGTCTCTTGACATATCGA
ACGTGTGACCTTGATGTTGACCCATTTATACAGTACGGATATGGCGCTCCTCAAAGACAAGTCCTTCAAGAAGTATGTTGACATCTATGCCGATAACGAAGAGAAATTCTTTAGCGAGTG
AGTGCTTGGTAGTGATAAGGCCGCTGCTGGCAGTCACTGACCCCACCGTAGCTTCGCGAAAGCATTCTCCAAGCTCATTGAGCTTGGTGTCCCTGAGAGGCAATGGGCTGGTGAACCTTG
GACTTTGGGAACCAGCGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAGAGCTCCCAATTTGATACGATCAGCCGCTGGCCGAAGAGCCAGTCAAACTTTGAACCTGCGTTCTCAAGTTATTCGACGACGATTTGCAACTGAGGGTGGACCGGAGATT
ACCAAACCATCTTCTCCACGATCTTCGAACACTCGTTATCTCCTCGCAGGTGTCGGTATCGCTGCCGTCGGCGCTGCATACTATTTCTACGGCACTGGCAGAACCGCGCACGATTCCGCC
AATAAAGCTGACACGGTAGTGCGTGGAGCTGTTGCCACGGTTGAGGCCAAGACGGGTCTCCGAAGAGGCAAGGACGAGTATCAAAAAGTCTATAATCGGATTGCCGAGACTCTCGAGAAG
GAGGGTTACGACG
ACGGTTCTTTGGCCCCCGTCCTTCTTCGCTTGGCTTGGCACTCCTCTGGCACCTATAACAAAGAGGATGGTACTGGAGGATCGAACTTTGCTACCATGAGGTTCAAG
CCCGAGGCCGAGCACAGCGCGAACAATGGCCTA
CATGTTGCCAGGGAACATATGGAAAAGATCAAGCAAGAGTTCCCCTGGATCTCTTACGGTGACCTATGGACCCTCGGTGGAGTCTGT
GCTGTCCAGGAGTCGGGCGGACCTACCATCCCTTGGAGGCCTGGCAGAATTGACGGCTTCGAAGCTCAAGTCACTCCCGATGGTAGGCTACCGGATGCCTCTCAAGCCCAAGACCATCTG
AGGTTCATCTTTAACCGCATGGG
CTTCAATGACCAAGAAATTGTTGCCCTTAGCGGCGCTCATGCCATGGGGCGATGTCATACTAATCGATCGGGCTTTGAGGGCCCTTGGACTTTCTCC
CCTGTCACCTTTTCCAACCAGTACTTTGCTCTTCTCCGAGACGAGCCTTGGCAGTGGAAGAAGTG
GACCGGACCTGCCCAATATGAAGACAAAAACACAAAGACCTTGATGATGCTTCCT
ACGGATATGGCGCTCCTCAAAGACAAGTCCTTCAAGAAGTATGTTGACATCTATGCCGATAACGAAGAGAAATTCTTTAGCGA
CTTCGCGAAAGCATTCTCCAAGCTCATTGAGCTTGGT
GTCCCTGAGAGGCAATGGGCTGGTGAACCTTGGACTTTGGGAACCAGCGATTAA

Retrieve as FASTA