Entry information : AtPrx70 (At5g64110 / PER70 / AtperoxP70 / ATP45)
Entry ID 236
Creation 2006-02-07 (Filippo Passardi)
Last sequence changes 2015-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: AtPrx70 (At5g64110 / PER70 / AtperoxP70 / ATP45)
Name (synonym) AtPrx70 (At5g64110 / PER70 / AtperoxP70 / ATP45)
Class Class III peroxidase    [Orthogroup: Prx087]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Mixed tissues
Rosettes
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx70
start..stop
S start..stop
AlyPrx70 643 0 1..330 1..332
BstrPrx73 604 0 1..330 1..331
CrubPrx81 584 0 1..330 1..331
TsPrx70 544 0 1..330 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25655530..25655946 417 N° 2 25655236..25655395 160 N° 3 25654575..25654990 416  
complement(join(25654575..25654990,25655236..25655395,25655530..25655946))


exon

Literature and cross-references AtPrx70 (At5g64110 / PER70 / AtperoxP70 / ATP45)
Protein ref. UniProtKB:   Q9FMI7
DNA ref. Phytozome 11:   Chr5 (25655946..25654575)
mRNA ref. GenBank:   NM_125807
Cluster/Prediction ref. Phytozome Gene 11:   19670763 UniGene:   At.28572
Omic ref. AtProteome:   At5g64110 ATTED-II:   At5g64110 e-FP Browser:   At5g64110 ePlant:   At5g64110 Genevestigator:   At5g64110 TAIR:   At5g64110
Protein sequence: AtPrx70 (At5g64110 / PER70 / AtperoxP70 / ATP45)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (306)
PWM (Da):   %s   36000.47 (33275.1)  
PI (pH):   %s   6.97 (6.65) Peptide Signal:   %s   cut: 25 range:25-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSFTNLNPCYVLLPFFLVLATNATHTNNFLPRPRTGYYGSACWNVESIVRSVVESNYLANPANAPGILRMHFHDCFVQGCDASVLLAGPNSERTAIPNLSLRGFNVIEEAKTQLEIACPRTVSCADILALAARDFVHLAGGPWWPVPLGRLDGRISLASNVILPGPTDSVAVQKLRFAEKNLNTQDLVVLAAGHTIGTAGCIVFRDRFFNYDNTGSPDPTIAPSFVPLIQAQCPLNGDPATRVVLDTGSGDQFDTSYLNNLKNGRGLLESDQVLWTNLETRPIVERLLGLRFPFLIFGLEFARSMTKMSQIEIKTGLDGEIRRVCSAVN

Retrieve as FASTA  
Remarks Complete sequenc efrom genomic (introns 2 and 3), 5 cDNA and 3 ESTs
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTTTTATATA AAAACATCAT TTATTATAAC CAATTTAACC AATAAAAAAT AGATGATTAA ATATAATTGG TTAAAAAATA TTAAATACAT TTATTATTTG CATAGAAAAT TGAAAACGAC  ATTTAAATTG AAAAAAAATA AAAATCCTTA AACTACATTT ATATAGAAAC AGAAGAAGTA TATTTATCTT AAAGTTGTAC GTAATGTATA GTTATTTTGT GTATTTTCAA ACGTGTGTTA  TAATTAGGAT GGATTGATTT GATTGCTGTA CATGGTTTTT CCGAAATTCT AAAAATATAC CCCGTGACAA AATTTGATGA CTTTTGTGTC AGAAGACAAA CAGTTGAAAT AAAGTTGGGG  TTGTCCATGT ATTTAGTACT ATTTACGATC AAAAGACTAA AAATAGAACC TTCTCGGTAT TTAACTCAAA CTTCTTTCGT GTTTAATTAT TGTCGTATAC CATCTATATC CAAAGTAGCA  GTTTCGGAAT TTAGAAGGCT AAACTAAAAC TAAATTATTT TTTAAGCGGT AAACCCTAAA CTAGTCAGGA TGGGGACTTT AATATTGACT GATACATAGT ATTACACGCA GTATTGAGTA  TTAAACTTCA TTTTTTAAAG TATATTAGTA ATATGTTTAA AATCTCAAGA AAAAATAGCA GTAAACACAT AAATATTTAG AATTTTATCC TCATATATAC TATACTTTTA GGGTAAGTTC  TCGTTATAAT GACTGTGTGT TGAAAACTTA ATATTAATGA TTGCATAAGT GATTTAAGAA TTGATGTTGA AGACAGTCCT CGTGCCTTCG TACAAATAAA ACGCGTGAAA AAATAACGAG  AAGTACTTTA GAAAAAGAAG GATAATAACG ATACGTGATT TTTACGTAAT TACCAGAGAA AATGGCCGAC AATCCGTCTT ATCCATTTAT AGTATATTTT CCTTTTTCCA GTGGTTTTAT  GAGGAATTAT ATCATAGATT TAATTTGATT AGTTACAAAA TTGTAAAGAT ATTTAAGAAA TACAAAAATT AGAAATTCTT TCAAGCAAAG AGGTATCAAA TTTTGATGCT AGATAATTTA  GTTTAAAATT TTTCAAACTT TCTAGTCGTC CCGTTACAAC ATCAATTTTT TTGCCTACTT GATCGACTAG TTGCAATATA AATATATAGT TAACTACATC CAACTTTATT AACTTCTTTT  TTTATATTCT TTGTCAACAC ATTAATGGTA CTATATGATA TATCCCTGCT TCTTCTTCTT CATTTTTTTT TTGTTTCCGT CAAACTCAAA TCCATATCTA TAGGATCCGC ATATAATAAG  TTTTCGTGAT GTTGACAAAC ATTCGCAAAC AAACACAAAT TGAAGGAAAA AAATCAATAT TTAATATGGT TGTCCGACTC GTCAAAATAT TATTAACCCT ATGCGTTGCG TGTATGATAC  TTAACGCATA TTGACTATTA ACTAAGCAAT GCAATGATTA TAATTAAATC CCATACTCAT TTCAGGGCAA ACCCATTAAT CTTGAACGGA CGATTATGAT ATTATTAAGT TTATATACAC  ACATATTTGA GTCATTGATC AATGCACCAC AGCACCTGAT CTTGATTGTG GTTCAAATAA TACTAATGTT TCCCAAAATT ATCTATAAGC TAAATAGCAT AAAATTTAAT TAGGTTAAAA  GAGAGAGAAC AAATCACAAA TCTACTTATA GGTAGTTAGG CACATACATG GACCATATTT CATATGCTTA ATTACAATAT TAACAAAATA AATCAACAAA GAATTAAATA TCACGACTAA  ATACAACGTA GCTCCAATTA GTTGATGAGT AGCCCGGCAT TGCTTACTCA TTAAACTCTG CGAATCTTTT ACTCTTTTCC ACTATAAATA TATATACACA CACAATTCTC AAACTATTAA 
ACGCAACAAA TCAAAAGTAA TAATCCAAAT TATATATACA TATATGCACC ATTTGGTTAA AAACTAAGAA GAAACCAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAATATAAG ATTAATTAAC CATTACAATA TGATATAAAG TAATGAATAA AAATGGAGAT TATATAGACT CTCCAGCTTT TAATAATAAA CCAGCTAGTT TAACATTTTC TTTTAATGTG  ACTAAGAGGT TTAATTACGA CGATGTGAGT GTGAGGGAAT ACGTGTTTAA ATCACACATA AGAAAAAAGA AATCCTATGT AATTGTAATC TCTTAAGAAA ATTTAAAATA AGCTATATAT  GTGTAATACT GAAATTCTCC TACTTTAGAA TATTTTATGG CTGTTAATTA TGAAAAAAAA AATTGGACTA TAAACAGAAA CAATTAATTA ATGGATATAT CAAAAAAAAA AAACGCAAAC  GTAAAATAGA ATAACATTTA GGTCAATAAA ATTAACCAAT TGAGTTAATA ATATATATAA CGTCTAAATA TGTACATTAG TTTCCAACTC GAGGCAATGA AAGTTTTTTT TTTTTTAATT  CAATAAAGGA TGTAATGAAA ATAAGGATGA TTGGTTTTCA AGATGAAGTT AAATTTCATA AAATAGTATA TTTGGTATCA CGAGATTTTC GCCAATTTCC GGCAGAAAAC TGGGTGATGA  ATATTAGTCT CATCTCATAT TGTATAATGT ACATGTACGT GCTCGGTGAT GGGTGAAATT TGTCCTCTCC GTCTCTGGTT TTTATAACTA GACCGATATT AATTAAAATT ATGTGTCCTG  TATAAAGTTA TCGTTCTTAA TTATACTTGA AATGTGAATA TTGGTTCCTT TCTTTATCTT AATCTATAAC TCTTAACTGT AAAGTGAAAT TTGAATAAGA CTTTTACAAA AAACATAAAA  TACAATTAGT GAAGTCAATC AAAGTTGGAA CGATTCAGTT TGAATTCACT GTTCGAAATG AATCTAATCA TTGGTGGAAA ATGATTAAAG GGATAATAGT AAGGATAATT ATATATCAGT 
GGTTGACTTT GACAATAAAG AAAAAGACAA GTCAATGATA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGTTTTACTAATTTAAATCCTTGCTACGTTCTCTTACCGTTCTTCCTTGTCCTAGCCACGAATGCAACACATACAAACAATTTCCTCCCAAGGCCACGGACTGGGTATTACGGT
AGTGCATGCTGGAATGTAGAATCGATAGTTCGGTCCGTGGTTGAGTCTAACTATCTTGCTAATCCAGCCAATGCTCCAGGCATTTTGCGTATGCACTTTCACGATTGTTTCGTTCAAGGC
TGTGACGCCTCCGTTCTCCTAGCCGGACCTAACTCTGAGCGAACGGCGATTCCAAATCTATCGTTGAGAGGGTTTAATGTCATTGAAGAAGCTAAGACTCAGCTTGAGATCGCTTGTCCT
CGAACAGTCTCTTGTGCTGATATCCTCGCACTCGCTGCACGTGACTTCGTCCATTTG
GTATAACTTACTTTTCTAATTTTACTTAATTATATACATAAGTCTATCGTGCGTCTTGGGTTT
TAACGTCACATGCATATATGTCTATCTATTGACAACGTGATTAAATGAAAGTTTTATACGTATGCATATAGGCCGGTGGACCATGGTGGCCAGTTCCATTGGGGAGACTCGATGGCCGAA
TTTCTCTAGCCTCGAATGTCATTTTGCCGGGACCTACCGACTCCGTTGCCGTGCAGAAGCTGAGGTTTGCCGAAAAAAATCTTAATACCCAAGATCTCGTTGTCCTTGCTG
GTACGTAGT
GATTTTATAAGGCCTCGATCGCTTGTGTTAAAACATTGTTTTTTCGATTATGTTTGCATGTGAAAATTCTACCTTTTTTATATATTTCTGCAAACGTAAAGTCGTAAACAAAGAATCAAA
GCTAGCTTAACATTCAAAGGAGATAATAAATACTTTCTGTATGTTACAAATTACATATTTTGAAATTGTCATGAAGACACCTGGCTAATTCACATAGAGGGCTTGGTATATAACAGCTGG
ACATACGATAGGAACGGCCGGATGTATTGTGTTTAGGGACAGATTCTTCAACTACGACAACACAGGAAGTCCGGACCCAACCATCGCCCCGAGTTTTGTCCCTCTGATCCAAGCTCAATG
CCCTCTGAATGGTGACCCCGCGACTCGTGTAGTGCTGGACACGGGAAGTGGTGACCAATTTGATACGTCGTACCTTAACAACTTGAAGAACGGTCGAGGTCTCCTCGAGTCTGATCAGGT
CCTATGGACTAATCTCGAGACCCGACCCATCGTGGAAAGGCTTCTAGGACTACGGTTTCCGTTTCTTATTTTCGGACTGGAGTTCGCGAGGTCCATGACCAAGATGAGTCAAATCGAGAT
CAAGACGGGTTTGGATGGGGAGATTCGTAGGGTTTGTTCTGCGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGTTTTACTAATTTAAATCCTTGCTACGTTCTCTTACCGTTCTTCCTTGTCCTAGCCACGAATGCAACACATACAAACAATTTCCTCCCAAGGCCACGGACTGGGTATTACGGT
AGTGCATGCTGGAATGTAGAATCGATAGTTCGGTCCGTGGTTGAGTCTAACTATCTTGCTAATCCAGCCAATGCTCCAGGCATTTTGCGTATGCACTTTCACGATTGTTTCGTTCAAGGC
TGTGACGCCTCCGTTCTCCTAGCCGGACCTAACTCTGAGCGAACGGCGATTCCAAATCTATCGTTGAGAGGGTTTAATGTCATTGAAGAAGCTAAGACTCAGCTTGAGATCGCTTGTCCT
CGAACAGTCTCTTGTGCTGATATCCTCGCACTCGCTGCACGTGACTTCGTCCATTTG
GCCGGTGGACCATGGTGGCCAGTTCCATTGGGGAGACTCGATGGCCGAATTTCTCTAGCCTCG
AATGTCATTTTGCCGGGACCTACCGACTCCGTTGCCGTGCAGAAGCTGAGGTTTGCCGAAAAAAATCTTAATACCCAAGATCTCGTTGTCCTTGCTG
CTGGACATACGATAGGAACGGCC
GGATGTATTGTGTTTAGGGACAGATTCTTCAACTACGACAACACAGGAAGTCCGGACCCAACCATCGCCCCGAGTTTTGTCCCTCTGATCCAAGCTCAATGCCCTCTGAATGGTGACCCC
GCGACTCGTGTAGTGCTGGACACGGGAAGTGGTGACCAATTTGATACGTCGTACCTTAACAACTTGAAGAACGGTCGAGGTCTCCTCGAGTCTGATCAGGTCCTATGGACTAATCTCGAG
ACCCGACCCATCGTGGAAAGGCTTCTAGGACTACGGTTTCCGTTTCTTATTTTCGGACTGGAGTTCGCGAGGTCCATGACCAAGATGAGTCAAATCGAGATCAAGACGGGTTTGGATGGG
GAGATTCGTAGGGTTTGTTCTGCGGTTAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTAAACGCA ACAAATCAAA AGTAATAATC CAAATTATAT ATACATATAT GCACCATTTG GTTAAAAACT AAGAAGAAAC CAAAATGAGA AGTTTTACTA ATTTAAATCC TTGCTACGTT  CTCTTACCGT TCTTCCTTGT CCTAGCCACG AATGCAACAC ATACAAACAA TTTCCTCCCA AGGCCACGGA CTGGGTATTA CGGTAGTGCA TGCTGGAATG TAGAATCGAT AGTTCGGTCC  GTGGTTGAGT CTAACTATCT TGCTAATCCA GCCAATGCTC CAGGCATTTT GCGTATGCAC TTTCACGATT GTTTCGTTCA AGGCTGTGAC GCCTCCGTTC TCCTAGCCGG ACCTAACTCT  GAGCGAACGG CGATTCCAAA TCTATCGTTG AGAGGGTTTA ATGTCATTGA AGAAGCTAAG ACTCAGCTTG AGATCGCTTG TCCTCGAACA GTCTCTTGTG CTGATATCCT CGCACTCGCT  GCACGTGACT TCGTCCATTT GGCCGGTGGA CCATGGTGGC CAGTTCCATT GGGGAGACTC GATGGCCGAA TTTCTCTAGC CTCGAATGTC ATTTTGCCGG GACCTACCGA CTCCGTTGCC  GTGCAGAAGC TGAGGTTTGC CGAAAAAAAT CTTAATACCC AAGATCTCGT TGTCCTTGCT GCTGGACATA CGATAGGAAC GGCCGGATGT ATTGTGTTTA GGGACAGATT CTTCAACTAC  GACAACACAG GAAGTCCGGA CCCAACCATC GCCCCGAGTT TTGTCCCTCT GATCCAAGCT CAATGCCCTC TGAATGGTGA CCCCGCGACT CGTGTAGTGC TGGACACGGG AAGTGGTGAC  CAATTTGATA CGTCGTACCT TAACAACTTG AAGAACGGTC GAGGTCTCCT CGAGTCTGAT CAGGTCCTAT GGACTAATCT CGAGACCCGA CCCATCGTGG AAAGGCTTCT AGGACTACGG  TTTCCGTTTC TTATTTTCGG ACTGGAGTTC GCGAGGTCCA TGACCAAGAT GAGTCAAATC GAGATCAAGA CGGGTTTGGA TGGGGAGATT CGTAGGGTTT GTTCTGCGGT TAACTAATTA  ATATAAGATT AATTAACCAT TACAATATGA TATAAAGTAA TGAATAAAAA TGGAGATTAT ATAGACTCTC CAGCTTTTAA TAATAAACCA GCTAGTTTAA CATTTTCTTT TAATGTGACT  AAGAGGTTTA ATTACGACGA TGTGAGTGTG AGGGAATACG TGTTTAAATC ACACATAAGA AAAAAGAAAT CCTATGTAAT TGTAATCTCT TAAGAAAATT TAAAATAAGC TATATATGTG 
TAATACTGAA ATTCTCCTAC TTTAGAATAT TTTATGGCTT TTTTTTTTTT TTAATTCAAT AAAGGATGTA ATGAAAA 

Retrieve as FASTA