Entry information : AtPrx73 (At5g67400 / PER73 / AtperoxP73 / PRXR11 / ATP10a / AtP10 / Atprxr11g / RHS19)
Entry ID 239
Creation 2006-02-07 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx73 (At5g67400 / PER73 / AtperoxP73 / PRXR11 / ATP10a / AtP10 / Atprxr11g / RHS19)
Name (synonym) AtPrx73 (At5g67400 / PER73 / AtperoxP73 / PRXR11 / ATP10a / AtP10 / Atprxr11g / RHS19)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx73
start..stop
S start..stop
CagraPrx64 633 0 1..329 1..329
CrubPrx63 631 0 1..329 1..329
BstrPrx21 631 0 1..329 1..329
AlyPrx73 629 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26894896..26895111 216 N° 2 26895198..26895398 201 N° 3 26895563..26895728 166 N° 4 26895894..26896300 407
join(26894896..26895111,26895198..26895398,26895563..26895728,26895894..26896300 )


exon

Literature and cross-references AtPrx73 (At5g67400 / PER73 / AtperoxP73 / PRXR11 / ATP10a / AtP10 / Atprxr11g / RHS19)
Protein ref. UniProtKB:   Q43873
DNA ref. Phytozome 12:   Chr5 (26894896..26896300)
mRNA ref. GenBank:   NM_126140
Cluster/Prediction ref. Phytozome Gene 12:   19672175 UniGene:   At.95
Omic ref. AtProteome:   At5g67400 ATTED-II:   At5g67400 e-FP Browser:   At5g67400 ePlant:   At5g67400 Genevestigator:   At5g67400 TAIR:   At5g67400
Protein sequence: AtPrx73 (At5g67400 / PER73 / AtperoxP73 / PRXR11 / ATP10a / AtP10 / Atprxr11g / RHS19)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   35790.57 (33139.2)  
PI (pH):   %s   9.93 (9.93) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFSLVVVVTLSLAISMFPDTTTAQLKTNFYGNSCPNVEQIVKKVVQEKIKQTFVTIPATLRLFFHDCFVNGCDASVMIQSTPTNKAEKDHPDNISLAGDGFDVVIKAKKALDAIPSCKNKVSCADILALATRDVVVAAKGPSYAVELGRFDGLVSTAASVNGNLPGPNNKVTELNKLFAKNKLTQEDMIALSAAHTLGFAHCGKVFNRIYNFNLTHAVDPTLNKAYAKELQLACPKTVDPRIAINMDPTTPRQFDNIYFKNLQQGKGLFTSDQVLFTDGRSKPTVNDWAKNSVAFNKAFVTAMTKLGRVGVKTRRNGNIRRDCGAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), 4 cDNA and 11 ESTs (10 only in roots)
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTAAATCTT CTAAATTCTT GCTTTTAGAG TTATTATATC ATTACCTAAA AGGCAAAAAA TATAAATTTT TTAATTATTA TTATTTATAT ATTTAAAATT CATAAAACAT TATTAATATT  TAAATTTATA AAAAGTTTAA TATATCAAAA AAAAATAACA TCATTATATA ATATATAGAG TTTAAAACAT CTCAAAAAAA AATTCGTCAT ATTTTGTGAT TCGAAATTTT AAGAATGAAC  ATATATTAAC TAATTGGCGA AAAATGTGTG GGTTTAACGT CCCGCAACGA ATAAAATATT TTGACAATGA TTCATAAACA TATTATAAAT AAGATCAACA TTAATAAAAT AAATAAATTT  TTTTTGTGGA TGGATTTGGC GGGACGGGTT TGGCAGGACG TTACTTAGTA ACAATTGTAA ACTATAAAAT AATTTACAAA TTATATATAT ATTAATTTAA AAAAATGAAT TGTCTACGCG  GTGTACCGCG GGTTAAAATC TAGTAGTATA TACATTCGTA ACAATTATTA GCATTCAGTT TGATTTTTGC TAATAATATA TATAGTATGG AATTTCATAC TGAAACTCAT TCTAAAATTT  GAAATATGTA GAAATTAAAA CAGTTAAGTA GACACCTGTT TCCAGTTTTG CTAATATATA TTGCAAATTC AGAATATATT TTCACCGGCT AACCATATAT AACAAGAAAA CTTGATAATT  AGTCTTCTAA ATATGTATGA ATCAAAAAAT TTAGTAATAT ATTATGTATA TATGCATATT TTGAAGAAAC AATATACGAC TAGTACTCAT AAAACATAGA GAATGTTCTT GAAGATTGGC  ATTTGCCAAA ATAAAATTCA AGTGCAATGA AGAAAAAAAA AGCTAAAGTA ATGTTGTCAT TAGCATTTTT ATTTTTATTT TTTTCCGGAG CATTTTTATT AATTTATTAA GGGCATATTT  TGCACATCAG ATCAAAGGAG TACTTTATTA CAGAAATTGA AAATTCGTTT GAAGACATGT TGAGAAAATC AAGGATCACG GCCTTCTGAA ATTCTGAACC TTGGGTTTCC CATTTCATAA  TCACGAGCTT GATTATTACT AGTATTGGAA AGTAAAATAA GATGATTAAA CAAGTGATTT TCTCAATTAC GTGTCACTAA CACTAAGGGT AATTATGATG ACCAATGGGT GACATCTCGA  TTTTATCAAA CGTCCCTTAA CTTTTTTCGA CGTCGAGATT TTATAAACCA GTAAAGGCAT TCTCTTTCAC TTTTTTCATT CCCTCATTTT TATAGAATCA GTTTAAGTTT TTCAATTGCT  AAGGGAATCG ATCGCCTATC AGGAGATTCT TCACATCCCT TATAAGCTCA TCTGAGGCAA GAAAACAAAA TAAAATGATT CAAAAACTAC ATCAAAAAAA AGTAATGGAC ATGAAATGAT  TCAAAAAAAG TTTTTGTTGC TATTTTTGCT CTGCACGAAT GTCACGTTTG AGAATCTTAT CCCTTCATAA ATTCCCCAAG TGTCAAATGT CATGCTTCTT GTTGCTCATA AAGACCCTTT  TAGATTCCCT GAGATGGATC CCCCAAAAAT ATATTTCTTA TTAGGTTGAG ATTCTCTAAC TTGTCCTTTC AAATGTCTAT GGGCCTGAAA GCCCATAAAA GTCAAAATTT CCAAAGTTGG  CCCAAAACAG AAAGATACTT CTGCGTAGAC ATTCTACAAA GTCAACGCTT AAATATGTCA TATTCTTTTA CTAATTCAAA TCCCAAGTTA CTAGAGAAGC AACTCGTCGG CCATCACCAA  GAACGTGGCT CCAAGTTATA TATGATTCGG CCGAATTTTG AAAACTTCTT CAAAAACATA TAGAATTGTT CTATCATTTT ATTGATAACT TCCATTTCAC CATTCCTATA AATACCATTC 
AATAGTTTTC TTCATTCTCA CACAACTTAG ACAATATCTC ACCATTCCTG TAAACACAAA AACTTGTAAT TTCCAACGAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCATCCTTTT TGGGTTTTGT TTTCGAGATT TGTTCTTTGA CATGTTATGA GTTTTTGTTT TGTTGTCTTC TGTTTGTTTC TGCTTCTTGT ATTTTTGAAA AACACATTAA CGAATCTATA  CCGTTGTTTT ATTTCTCGTG ACTGTAATAT TAATAATCTT ATTTCTATTA AACTTGTTTA ATAAATCCAA TCTGAGCATC AAAATCAAGA CAAACCAAGA CATATATACA CAAAACCTAA  AGATGTTCAA AACTTAAAAC TCTGTAAAGG AAGAATCTGA TCTATCTAGA GTTAGTAGCT TATCTGAATC TGCAGGCGAT CTTCTCAAGC TTTGTAGGCC AATCTTCCCC TAGTATCGAT  GGGTTTAACG CCATAGCTAC TTGAAAATCT ACCAGAGAAG ATGCTGATGA AGCGTTACTA GACCTTGAAG CTGCTAGTTC AAGACACGGT TTGATCAATC TCTTCAAGAA AACATCTAGC  CCTGCGTTTA ACGAGTTAGC AAACCCAACC GAAACCTCTA ATCCTTCCTC CAAGTCATCT TCGAGTTTCT TCTTTAAAGA AACCGAATCA GGAAGCTCAC CAGAGGAGTA ACAACACGTG  TCTATACGAT GTTGTTTCTT TATAACATCT CTAAGATTAA CACCAAAAGG AGCTTCAATA GGTTGACTTC TCCAACATGG AATCAATTGG TCAACTTCTT CAACATTTTC CATTGACCAT  TGTTGCCTAC CACTAGAAGA AACAACCTCA GTGACTAGAC TCTTCCCTTT GCTAATATTA CCATCTTTAT TAAGCCTCCG TTGAGTCCTT CCTTTACGAG GTGATCTAGG AAGTTCTTTG  CACAAAGATT GAAAAGCTCC ATTTAGTTGC TTCTTCTTCT TGTTATCTGA CTCTACACCA TTCTTTACGA ATGGAGGTAG TGTCTTTGAG AGACATATAT TCTTAAGAAT CCCTCTAAGC 
AAAGCGTTGT GTAGACTTAT ATTCTCCCTC TTCACCGTCA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGGTTCAGTCTGGTTGTAGTCGTGACTCTTAGTCTTGCCATCTCTATGTTCCCTGACACAACCACTGCTCAACTCAAAACCAATTTCTACGGAAACTCATGTCCGAATGTTGAA
CAAATCGTGAAAAAAGTCGTCCAAGAAAAAATCAAACAGACCTTCGTCACCATCCCAGCTACTCTCCGCCTCTTCTTCCACGATTGCTTCGTCAAT
GTAATGCTCAAACTTTTGTTGATT
TTTGTATTAGAAACCTTTTATGCAATGATTTCTTAAAAATTTTGGTTGGTATGTATAAATAGGGATGTGATGCGTCGGTCATGATTCAATCAACGCCTACCAACAAAGCCGAGAAGGATC
ATCCAGACAATATTTCTTTGGCCGGAGATGGATTTGACGTTGTGATCAAAGCCAAGAAAGCTCTTGACGCTATCCCAAGTTGCAAAAACAAAGTCTCTTGTGCTGATATTCTTGCTTTAG
CCACCCGTGATGTTGTTGTCGCC
GTAAGTTATATATTTCATTTTCTTCCAATCAGTATAAAAGTGTTTTTGGGGAAAAGAAATAAAAACCATATGTTAAATATTAAAACATGTGTTATCT
ATTATACAACAATGATTAAGTGGTGTACGTGTACGCAATTTTCAAAAAAAAGTTCGGATGTGTGTAGGCCAAAGGTCCGTCGTACGCAGTGGAACTCGGAAGGTTTGATGGTTTGGTGTC
GACTGCGGCTAGCGTTAACGGAAACTTGCCCGGACCAAATAACAAAGTTACAGAACTTAACAAGCTTTTTGCCAAAAACAAACTTACCCAAGAGGACATGATCGCTCTTTCAG
GTAATGC
ATGATAACATACGTTTATATATATGAAGATAGATTGGTTTAGTTACAAATAAATTTTTGCTCAATATTGGTATTTTTTGTCCATCCCTTAAAAGTAGACCACTTATATATCAACAAAGTG
GATCTAATCTAAGCTATTAAATTTGTCCAATAATGCAGCGGCTCACACACTTGGATTCGCCCATTGTGGCAAAGTGTTCAACAGAATCTACAACTTCAACCTCACACACGCCGTTGACCC
AACTCTAAACAAAGCCTACGCTAAAGAACTTCAGTTGGCTTGTCCCAAGACAGTTGACCCAAGAATCGCCATCAACATGGACCCAACCACTCCAAGACAATTCGACAACATTTACTTCAA
GAATCTGCAACAAGGCAAAGGACTCTTCACTTCCGACCAAGTTCTCTTCACCGATGGTCGCTCAAAGCCCACCGTTAACGATTGGGCCAAGAATTCTGTTGCTTTCAACAAGGCTTTCGT
AACCGCTATGACCAAACTCGGCCGCGTTGGCGTTAAGACTAGACGCAACGGTAACATTCGTCGTGACTGTGGTGCCTTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGGTTCAGTCTGGTTGTAGTCGTGACTCTTAGTCTTGCCATCTCTATGTTCCCTGACACAACCACTGCTCAACTCAAAACCAATTTCTACGGAAACTCATGTCCGAATGTTGAA
CAAATCGTGAAAAAAGTCGTCCAAGAAAAAATCAAACAGACCTTCGTCACCATCCCAGCTACTCTCCGCCTCTTCTTCCACGATTGCTTCGTCAAT
GGATGTGATGCGTCGGTCATGATT
CAATCAACGCCTACCAACAAAGCCGAGAAGGATCATCCAGACAATATTTCTTTGGCCGGAGATGGATTTGACGTTGTGATCAAAGCCAAGAAAGCTCTTGACGCTATCCCAAGTTGCAAA
AACAAAGTCTCTTGTGCTGATATTCTTGCTTTAGCCACCCGTGATGTTGTTGTCGCC
GCCAAAGGTCCGTCGTACGCAGTGGAACTCGGAAGGTTTGATGGTTTGGTGTCGACTGCGGCT
AGCGTTAACGGAAACTTGCCCGGACCAAATAACAAAGTTACAGAACTTAACAAGCTTTTTGCCAAAAACAAACTTACCCAAGAGGACATGATCGCTCTTTCAG
CGGCTCACACACTTGGA
TTCGCCCATTGTGGCAAAGTGTTCAACAGAATCTACAACTTCAACCTCACACACGCCGTTGACCCAACTCTAAACAAAGCCTACGCTAAAGAACTTCAGTTGGCTTGTCCCAAGACAGTT
GACCCAAGAATCGCCATCAACATGGACCCAACCACTCCAAGACAATTCGACAACATTTACTTCAAGAATCTGCAACAAGGCAAAGGACTCTTCACTTCCGACCAAGTTCTCTTCACCGAT
GGTCGCTCAAAGCCCACCGTTAACGATTGGGCCAAGAATTCTGTTGCTTTCAACAAGGCTTTCGTAACCGCTATGACCAAACTCGGCCGCGTTGGCGTTAAGACTAGACGCAACGGTAAC
ATTCGTCGTGACTGTGGTGCCTTTAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACCATTCCTG TAAACACAAA AACTTGTAAT TTCCAACGAA ATGGCGCGGT TCAGTCTGGT TGTAGTCGTG ACTCTTAGTC TTGCCATCTC TATGTTCCCT GACACAACCA CTGCTCAACT  CAAAACCAAT TTCTACGGAA ACTCATGTCC GAATGTTGAA CAAATCGTGA AAAAAGTCGT CCAAGAAAAA ATCAAACAGA CCTTCGTCAC CATCCCAGCT ACTCTCCGCC TCTTCTTCCA  CGATTGCTTC GTCAATGGAT GTGATGCGTC GGTCATGATT CAATCAACGC CTACCAACAA AGCCGAGAAG GATCATCCAG ACAATATTTC TTTGGCCGGA GATGGATTTG ACGTTGTGAT  CAAAGCCAAG AAAGCTCTTG ACGCTATCCC AAGTTGCAAA AACAAAGTCT CTTGTGCTGA TATTCTTGCT TTAGCCACCC GTGATGTTGT TGTCGCCGCC AAAGGTCCGT CGTACGCAGT  GGAACTCGGA AGGTTTGATG GTTTGGTGTC GACTGCGGCT AGCGTTAACG GAAACTTGCC CGGACCAAAT AACAAAGTTA CAGAACTTAA CAAGCTTTTT GCCAAAAACA AACTTACCCA  AGAGGACATG ATCGCTCTTT CAGCGGCTCA CACACTTGGA TTCGCCCATT GTGGCAAAGT GTTCAACAGA ATCTACAACT TCAACCTCAC ACACGCCGTT GACCCAACTC TAAACAAAGC  CTACGCTAAA GAACTTCAGT TGGCTTGTCC CAAGACAGTT GACCCAAGAA TCGCCATCAA CATGGACCCA ACCACTCCAA GACAATTCGA CAACATTTAC TTCAAGAATC TGCAACAAGG  CAAAGGACTC TTCACTTCCG ACCAAGTTCT CTTCACCGAT GGTCGCTCAA AGCCCACCGT TAACGATTGG GCCAAGAATT CTGTTGCTTT CAACAAGGCT TTCGTAACCG CTATGACCAA  ACTCGGCCGC GTTGGCGTTA AGACTAGACG CAACGGTAAC ATTCGTCGTG ACTGTGGTGC CTTTAACTGA TCATCCTTTT TGGGTTTTGT TTTCGAGATT TGTTCTTTGA CATGTTATGA  GTTTTTGTTT TGTTGTCTTC TGTTTGTTTC TGCTTCTTGT ATTTTTGAAA AACACATTAA CGAATCTATA CCGTTGTTTT ATTTCTCGTG ACTGTAATAT TAATAATCTT ATTTCTATTA 
AACTTGTTTA ATAAATCC 

Retrieve as FASTA