Entry information : PoVP06_IS-1 (mnp3)
Entry ID 2391
Creation 2006-09-21 (Christophe Dunand)
Last sequence changes 2012-10-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-10-29 (Christophe Dunand)
Peroxidase information: PoVP06_IS-1 (mnp3)
Name (synonym) PoVP06_IS-1 (mnp3)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP06_IS-1
start..stop
S start..stop
PoVP06_PC9 688 0 1..345 1..344
PoVP06_PC15 688 0 1..345 1..344
PoVP04_PC15 557 0 1..358 1..357
PoVP04_PC9 537 0 1..345 1..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22..269 248 N° 2 326..460 135 N° 3 510..634 125 N° 4 686..761 76
N° 5 822..947 126 N° 6 999..1068 70 N° 7 1124..1133 10 N° 8 1185..1220 36
N° 9 1276..1448 173 N° 10 1520..1566 47 N° 11 1597..1627 31  
join(22..269,326..460,510..634,686..761,822..947,999..1068,1124..1133,1185..1220 ,1276..1448,1520..1566,1597..1627)


exon

Literature and cross-references PoVP06_IS-1 (mnp3)
Literature Irie T., Honda Y., Ha H.-C., Watanabe T., Kuwahara M. Isolation of cDNA and genomic fragments encoding the major manganese peroxidase isozyme from the white rot basidiomycete Pleurotus ostreatus. J. Wood Sci. 41:230-233(2000).
Protein ref. UniProtKB:   O74640   O74179 [Incorrect splicing]
DNA ref. GenBank:   AB016519
mRNA ref. GenBank:   AB011546
Protein sequence: PoVP06_IS-1 (mnp3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (337)
PWM (Da):   %s   37404.5 (35147.3)  
PI (pH):   %s   4.42 (4.28) Peptide Signal:   %s   cut: 22 range:22-358
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKHFSSLVLLTLASQAVRGAVMKRATCADGRTTANAACCVLFPILDDIQEALFDGAECGEEVHESLRLTFHDAIGFSPTKGGGGADGSIVTFDEIETAFHANGGIDDIVDAQKPFIARHNISAGDFSIQFAGAVGVSNCPGAPRLNFLLGRPPATAASPNGLIPEPFDTVTDILARMGDAGFSPEEVVALLASHSVAAADHVDETIPGTPFDSTPGEFDSQFFIETQLRGTAFPGVGGNQGEVESPLAGEIRIQSDHDLARDSRTACEWQSFVNNQAKLQSAFKAAMDKLATLGQDRSKLIDCSDVIPVPKPLQSKAHFPAGLTMNNIEQACASTPFPALTADPGPVTTVPPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns) and mRNA. Incorrect prediction of the last exon in one swiss prot entries O74179 (CASTPF is missing ). Strain="IS-1".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCACTTCTCGTCCCTTGTCCTCCTGACTTTGGCATCTCAAGCCGTCCGAGGCGCTGTCATGAAGCGTGCTACTTGTGCTGACGGACGTACTACTGCGAACGCCGCCTGC
TGCGTCCTATTCCCCATTCTGGATGACATCCAAGAGGCCCTCTTTGATGGTGCCGAGTGTGGTGAAGAGGTTCACGAGTCCCTTCGACTCACTTTCCATGACGCTATTGGTTTCTCACCA
ACCAAAGG
GTATGTGCAAACCTTCGCATCTTCGTGAATGGTGACTGACGACAAACACTCAATAGTGGAGGAGGTGCCGACGGCTCCATCGTCACTTTCGACGAGATCGAAACCGCTTTCC
ACGCCAACGGTGGAATCGACGACATTGTCGATGCGCAGAAGCCATTCATTGCTCGCCACAACATCTCCGCCGGTGACTT
GTAAGTTCCTTTGGGAGAAGTAGCAGTGAACCCATGTAACG
AGTTATTGTAGCATTCAATTTGCTGGCGCAGTTGGTGTCAGTAACTGCCCAGGAGCTCCAAGACTCAACTTCTTGCTTGGTCGTCCGCCAGCTACAGCAGCTTCGCCCAATGGTTTGATC
CCTGAACCATTCG
GTACGTTTATTTCTTGAGTACCATCGGTTATGCTCTAATAGTGTACATCAGACACCGTCACCGATATCCTTGCCCGTATGGGTGACGCTGGCTTCAGCCCGGAAGAG
GTCGTTGCCCTTCTGGCCTC
GTAAGTCAAACAGTAACCTATCTACCTATCTTGAAAACTGATGTGCTTCGATAATTGTAGACACTCCGTTGCTGCCGCAGACCACGTCGATGAGACCATT
CCAGGAACACCCTTCGACTCCACTCCAGGAGAATTTGACTCTCAATTCTTCATCGAAACCCAACTCCGTGGCACTGCTTTCCCAGG
GTAAGCGATCCATTACGTCGATCGTAGTCGCCAA
TCTCACTTCTTGAACAGTGTTGGTGGTAACCAAGGAGAGGTCGAATCCCCTCTTGCTGGAGAAATCCGTATCCAATCAGATCACGATGTATGTCTTTTCCACCTAAACTCGCTTTTATTT
TTCTGATCAGCTGTCTTTCTAGCTTGCCCGCGGTATGTATCCTGCTTGACGGTATACTACTTGATCTCAAATGTTTGGTTCAGATTCTCGCACTGCTTGCGAGTGGCAATCCTTCGTTAG
TGAGTACAAGCAACACCATTTCTATGCTTCATCGCGATACTGAACACCCTCTAGACAACCAAGCCAAGCTCCAATCCGCTTTCAAGGCTGCTATGGACAAGTTGGCTACCCTCGGTCAAG
ACCGCTCGAAGCTCATTGACTGCTCTGACGTTATTCCTGTCCCCAAACCACTGCAGAGCAAGGCCCATTTCCCTGCCGGCCTGACAATGAACAACATTGAGCAAGCG
GTACGTGGAGAGG
CTCGATTTACTGATTTATCTTCTCACTATGGCTTCTTTAGTGTGCTTCTACTCCCTTCCCAGCTCTCACTGCCGACCCCGGCCCAGTCACCACTGTCCCCCCTGTGTAAGTCTCAAGCTC
TTCACGTTGTCATGTAACTCAACAGTTGTTCAGCCCCCCTTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCACTTCTCGTCCCTTGTCCTCCTGACTTTGGCATCTCAAGCCGTCCGAGGCGCTGTCATGAAGCGTGCTACTTGTGCTGACGGACGTACTACTGCGAACGCCGCCTGC
TGCGTCCTATTCCCCATTCTGGATGACATCCAAGAGGCCCTCTTTGATGGTGCCGAGTGTGGTGAAGAGGTTCACGAGTCCCTTCGACTCACTTTCCATGACGCTATTGGTTTCTCACCA
ACCAAAGG
TGGAGGAGGTGCCGACGGCTCCATCGTCACTTTCGACGAGATCGAAACCGCTTTCCACGCCAACGGTGGAATCGACGACATTGTCGATGCGCAGAAGCCATTCATTGCTCGC
CACAACATCTCCGCCGGTGACTT
TAGCATTCAATTTGCTGGCGCAGTTGGTGTCAGTAACTGCCCAGGAGCTCCAAGACTCAACTTCTTGCTTGGTCGTCCGCCAGCTACAGCAGCTTCG
CCCAATGGTTTGATCCCTGAACCATTCG
ACACCGTCACCGATATCCTTGCCCGTATGGGTGACGCTGGCTTCAGCCCGGAAGAGGTCGTTGCCCTTCTGGCCTCACACTCCGTTGCTGCC
GCAGACCACGTCGATGAGACCATTCCAGGAACACCCTTCGACTCCACTCCAGGAGAATTTGACTCTCAATTCTTCATCGAAACCCAACTCCGTGGCACTGCTTTCCCAGG
TGTTGGTGGT
AACCAAGGAGAGGTCGAATCCCCTCTTGCTGGAGAAATCCGTATCCAATCAGATCACGAT
CTTGCCCGCGATTCTCGCACTGCTTGCGAGTGGCAATCCTTCGTTAACAACCAAGCCAAG
CTCCAATCCGCTTTCAAGGCTGCTATGGACAAGTTGGCTACCCTCGGTCAAGACCGCTCGAAGCTCATTGACTGCTCTGACGTTATTCCTGTCCCCAAACCACTGCAGAGCAAGGCCCAT
TTCCCTGCCGGCCTGACAATGAACAACATTGAGCAAGCG
CCAGCTCTCACTGCCGACCCCGGCCCAGTCACCACTGTCCCCCCTGTAACTCAACAGTTGTTCAGCCCCCCTTCATAA

Retrieve as FASTA