Entry information : CsaPrx03 (Cucsa.153410.2 / CUSPEROX)
Entry ID 24
Creation 2006-03-23 (Christophe Dunand)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx03 (Cucsa.153410.2 / CUSPEROX)
Name (synonym) CsaPrx03 (Cucsa.153410.2 / CUSPEROX)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx03
start..stop
S start..stop
CmPrx02 602 0 5..326 11..332
CsaPrx02 502 0 13..281 1..269
CpPrx01 498 3e-179 18..338 14..325
CsaPrx01 476 1e-170 7..338 5..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 527635..527835 201 N° 2 527354..527542 189 N° 3 527107..527272 166 N° 4 526576..527036 461
complement(join(526576..527036,527107..527272,527354..527542,527635..527835))


exon

Literature and cross-references CsaPrx03 (Cucsa.153410.2 / CUSPEROX)
Literature Rasmussen,J.B., Smith,J.A., Williams,S., Burkhart,W., Ward,E.R., Somerville,S.C., Ryals,J. and Hammerschmidt,R.1992 unpublished
Protein ref. UniProtKB:   Q39650
DNA ref. Phytozome 12:   scaffold01124 (527835..526576)
mRNA ref. GenBank:   M91375
Protein sequence: CsaPrx03 (Cucsa.153410.2 / CUSPEROX)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (318)
PWM (Da):   %s   36585.2 (34421.1)  
PI (pH):   %s   5.46 (5.25) Peptide Signal:   %s   cut: 21 range:21-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAVASFFFLALLFRSSFAQLSETYYDQTCPRLPNIVRASVKKAIQSDIRAGAKLIRLHFHDCFVNGCDGSVLLEDAPGIVSELNSPGNQGIQGLEIVDAIKTDVEKECPGIVSCADILAQASKDSVDVQGGPSWRVLYGRRDSRIANKTGADSGLASPFETLDELKAKFAAVGLDSTDLVALSGAHTFGRSRCVFFSHRFANFNGTGSPDPSLDSNYRQFLEGVCSAGANTRANFDPVTPDVFDKNYYTNLQVGKGLLQSDQELFSTPGADTIAIVNSFAAREGTFFKEFRKSMINMGNIKPLTGKRGEIRRNCRRVNSNSGLFGEEEEEEGHDVM

Retrieve as FASTA  
Remarks Complete sequence from genomic and ESTs. Incorrect prediction from phytozome (Extra 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCCGTTGCCTCCTTTTTCTTTCTTGCCCTTCTCTTCCGCTCCTCTTTTGCTCAACTCTCCGAAACCTATTACGATCAAACCTGCCCTCGTCTCCCCAACATTGTCCGTGCC
TCCGTCAAGAAAGCCATCCAATCCGACATACGTGCCGGTGCTAAACTCATTCGCCTCCATTTCCATGATTGCTTCGTCAAT
GTACAAAAACTCTACACTTTTTCACCATCATCATCATCA
TCTCTCTCTTTTTTTCTACTTTTAATTGTATGGAGATTTAACTTATTTTGTAGGGATGCGATGGCTCTGTTTTGCTAGAGGATGCTCCTGGCATAGTCAGTGAGCTTAACTCACCTGGAA
ATCAAGGAATCCAAGGACTTGAAATTGTTGACGCCATTAAAACGGATGTCGAAAAAGAATGCCCCGGCATCGTCTCCTGTGCTGACATCCTAGCTCAAGCTTCCAAGGACTCTGTCGATG
TG
GTAAATAAATATATTTATTCGATTACAGTACTCTTCTTCTTTCTTTTGTTAAATGGGTATTCTTTGTTTCCCTTTTGTCAGCAAGGAGGGCCTAGCTGGAGAGTTTTATACGGAAGAA
GAGATAGCAGAATCGCTAACAAAACAGGGGCGGATAGTGGGTTAGCCAGTCCCTTCGAAACTCTAGATGAACTCAAAGCCAAATTTGCTGCTGTTGGGCTGGATAGCACTGATCTCGTCG
CTTTATCTG
GTAAAATGAAATGGATGAATTGAGCAGTAAATCAATTGATGGAATTGTGAGTAATTAATTTGATGGACAGGGGCGCATACATTTGGACGATCGAGATGCGTATTCTTCAGC
CACCGATTTGCGAATTTCAACGGAACTGGAAGCCCCGACCCATCACTGGATTCGAACTACAGGCAATTCCTTGAAGGGGTTTGTTCAGCAGGAGCAAACACAAGAGCCAATTTCGACCCG
GTAACACCAGATGTGTTCGACAAAAATTACTACACGAATCTTCAAGTGGGGAAGGGACTTTTACAGAGCGATCAAGAGCTGTTCTCTACTCCTGGGGCTGACACCATCGCCATTGTCAAC
AGCTTCGCTGCCAGAGAAGGAACATTCTTCAAGGAGTTCCGGAAGTCAATGATCAATATGGGAAATATTAAACCTTTGACTGGAAAGCGTGGGGAAATTAGAAGAAACTGTAGAAGGGTT
AATTCCAACTCTGGATTGTTCGGTGAAGAAGAAGAAGAAGAAGGCCATGATGTCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCCGTTGCCTCCTTTTTCTTTCTTGCCCTTCTCTTCCGCTCCTCTTTTGCTCAACTCTCCGAAACCTATTACGATCAAACCTGCCCTCGTCTCCCCAACATTGTCCGTGCC
TCCGTCAAGAAAGCCATCCAATCCGACATACGTGCCGGTGCTAAACTCATTCGCCTCCATTTCCATGATTGCTTCGTCAAT
GGATGCGATGGCTCTGTTTTGCTAGAGGATGCTCCTGGC
ATAGTCAGTGAGCTTAACTCACCTGGAAATCAAGGAATCCAAGGACTTGAAATTGTTGACGCCATTAAAACGGATGTCGAAAAAGAATGCCCCGGCATCGTCTCCTGTGCTGACATCCTA
GCTCAAGCTTCCAAGGACTCTGTCGATGTG
CAAGGAGGGCCTAGCTGGAGAGTTTTATACGGAAGAAGAGATAGCAGAATCGCTAACAAAACAGGGGCGGATAGTGGGTTAGCCAGTCCC
TTCGAAACTCTAGATGAACTCAAAGCCAAATTTGCTGCTGTTGGGCTGGATAGCACTGATCTCGTCGCTTTATCTG
GGGCGCATACATTTGGACGATCGAGATGCGTATTCTTCAGCCAC
CGATTTGCGAATTTCAACGGAACTGGAAGCCCCGACCCATCACTGGATTCGAACTACAGGCAATTCCTTGAAGGGGTTTGTTCAGCAGGAGCAAACACAAGAGCCAATTTCGACCCGGTA
ACACCAGATGTGTTCGACAAAAATTACTACACGAATCTTCAAGTGGGGAAGGGACTTTTACAGAGCGATCAAGAGCTGTTCTCTACTCCTGGGGCTGACACCATCGCCATTGTCAACAGC
TTCGCTGCCAGAGAAGGAACATTCTTCAAGGAGTTCCGGAAGTCAATGATCAATATGGGAAATATTAAACCTTTGACTGGAAAGCGTGGGGAAATTAGAAGAAACTGTAGAAGGGTTAAT
TCCAACTCTGGATTGTTCGGTGAAGAAGAAGAAGAAGAAGGCCATGATGTCATGTAA

Retrieve as FASTA