Entry information : AtPrx21 (At2g37130 / PER21 / AtperoxP21 / PRXR5 / ATP2 / Atp2a / Atprxr5ge)
Entry ID 240
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx21 (At2g37130 / PER21 / AtperoxP21 / PRXR5 / ATP2 / Atp2a / Atprxr5ge)
Name (synonym) AtPrx21 (At2g37130 / PER21 / AtperoxP21 / PRXR5 / ATP2 / Atp2a / Atprxr5ge)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Callus
Etiolated seedlings
Flowers
Leaves
Mixed tissues
Roots
Rosettes
Seedling shoots
Siliques
Stamen Abscission Zone
Whole seedlings
Inducers Dark growth
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx21
start..stop
S start..stop
BstrPrx19 671 0 1..327 1..327
AlyPrx21 670 0 1..327 1..327
BrPrx21-1Ab_other 630 0 6..327 7..328
BnPrx21-2_other 627 0 6..327 7..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15599929..15600004 76 N° 2 15599603..15599751 149 N° 3 15599309..15599497 189 N° 4 15599052..15599220 169
N° 5 15598225..15598625 401  
complement(join(15598225..15598625,15599052..15599220,15599309..15599497,1559960 3..15599751,15599929..15600004))


exon

Literature and cross-references AtPrx21 (At2g37130 / PER21 / AtperoxP21 / PRXR5 / ATP2 / Atp2a / Atprxr5ge)
Literature REFERENCE 1 Cai S, Lashbrook CC. Stamen abscission zone transcriptome profiling reveals new candidates for abscission control: enhanced retention of floral organs in transgenic plants overexpressing Arabidopsis ZINC FINGER PROTEIN2. Plant Physiol. 2008 Mar;146(3):1305-21
Protein ref. UniProtKB:   Q42580
DNA ref. Phytozome 11:   Chr2 (15600004..15598225)
mRNA ref. GenBank:   NM_129269
Cluster/Prediction ref. Phytozome Gene 11:   19639207 UniGene:   At.47592
Omic ref. AtProteome:   At2g37130 ATTED-II:   At2g37130 e-FP Browser:   At2g37130 ePlant:   At2g37130 Genevestigator:   At2g37130 TAIR:   At2g37130
Protein sequence: AtPrx21 (At2g37130 / PER21 / AtperoxP21 / PRXR5 / ATP2 / Atp2a / Atprxr5ge)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (299)
PWM (Da):   %s   36603.51 (33507.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.45 (7.18) Peptide Signal:   %s   cut: 29 range:29-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANAKPFCLLGFFCLLLQLFSIFHIGNGELEMNYYKESCPKAEEIIRQQVETLYYKHGNTAVSWLRNLFHDCVVSCDASLLLETARGVESEQKSKRSFGMRNFKYVKIIKDALEKECPSTVSCADIVALSARDGIVMLKGPKIEMIKTGRRDSRGSYLGDVETLIPNHNDSLSSVISTFNSIGIDVEATVALLGAHSVGRVHCVNLVHRLYPTIDPTLDPSYALYLKKRCPSPTPDPNAVLYSRNDRETPMVVDNMYYKNIMAHKGLLVIDDELATDPRTAPFVAKMAADNNYFHEQFSRGVRLLSETNPLTGDQGEIRKDCRYVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 4 introns, extra 5' introns), 9 cDNA and 139 ESTs. Over 50% of the ESTs are coming from dark grown material. Containing IntR (5').
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCTATGCATC TAAATCTGTA GTCACGTCGT AGCTAATGAC TACAAAACTT CCGTAGCCAT TTCTTCTCCA GTGTGCCTAC TGATATTCAT ATTAGCCAAT CGTGTCTTTT AACAACGTTT  AAGTTATGAT ACCATCAATC ACCCTTTGGC TATGTTATTG ATATAATACA TGTGACAAAT CGACCAATTA AGTCGTCTCT CTGATCAAAA CAACTTATAC GAATTCAAAA TCAATCTGAC  ATATTATTAT CACATAATTA GTTTTACAAA TCGAACTAAC CACACATTAA CCTGAATATC TATATAGTAA AAATTGTTAT TGGTGAAAGT GGATCATATA CTCGTATATA TAAGCAACTA  GATAAACCAC ATTAACTTCT AGATGTAGAC TTAAAGAAAA TAAGAATCAT TACATCAAGA ATATTGAGGA TAAGTGAATT GGCAACAAAG CATTATGTCT GCAAGTGAAT GGATTGGACG  GTAGTTAATG CAATTGTACA TGTATTTACA GCCGCCATAA TTAAGAAAGT GGGATTGGTT TTATTAGTAG TGGTTTGCGA ATGCGCATGC GATTACTGAA ATGTCTAAAA GGTCAAACTT  AATGGCTTTC AATTATTCAT TATATACACC AAGGAATCTT TTTCTTAATT CTTCTTTGGA TTTTCTTCTT AAAATATTAT ATTGTTACAT ATCTTTATTG CTGACATATA AAAATGTAAC  CTTTTTGCTT TCCAAACTAA CTAAAACTTT ACGGTAACTT TAAAATTCAT AACCAAATTG CTCATATTCG TACGAAAGAA TGATAGATGA ACAGCTACTT AAGGATCTTT TCAAATTTGA  TCAGACTTCT ATAGTAACAT TCTATCGAAG ATCGGATTCT TATCCCCAAT TCCCAACAAT ATATTTGAAT GATTGCTAGA TATATACTGT ATTAATAAGT AAACTTTATT AACGGTTGTA  CATAATCTTA AAAATTTAAG GTTTTTATTC AGTATTTTTG CCAAATATTT TGATGAGCAG TCTAATTCTT TCGTTCTTTT TTTGTTAAAA ATTAACAACT CTAACAGTAC TGAATATTTC  TGAAGTGAGC TAATGATTCC AAATTGGTAA CAATATCTTA AACGGAAGGT AAAATGCGGG TAAGTCTGGT AGAATCTGTT AAATTGAGGT AGCATAAATT TTACCACAAA AAAAAAAGCA  GAAAAGGATT ATAAGATTCA AAAAAAAAAA AAGTAAATTC ACTTAACCTT CTTTTTTTTA TTGTCAACTG ATTTTGTTAT TGATAAACTT GTTGGAACCA AGATAATAGG CCAAAACTTT  TTTATAATCA TATATATTAA ATAATAATTG TATTTAAGAT AATAGGCCAA TATAAGCTAT AGGTTAGCAT AGCGCTGAAA TTAAGAGAGT TGGGTATGTA GACGTTGACG TGTAATATTC  ATGATAATCA TTGCAAGCAA TTTTATTTAT TTTCTATACT AAGAACTATT TCAAATTGTA TACATATTAC TTTTTGGTGG AACATGAAAA TGTTTATAGA TTGCTGATTA ATATTTGAAG  GAAAAAATAA CAGAAAAATG GATATATACT TGAATCGGTT TGATAATATA TTGGAACAAA AGTGAAAAGC TAAATTAATT AATGCTACTG TGCTAGTATA TTACTATTTT TATCGAATTA  AATTGGACAT CGAGTCTCAC TGAATTCACA ATTTCACATG TTCAACAACT ATTGAGTTCA GATAGCTAGA TAGCTAGTGG TTTTAAATTT GAGTATTAAT ATGAGTTTAG AACGATTAAG  AAACCCCCGA TTATTGAAAA ATAATAATTA ATTAATAGTG ACAGCAACCA CTATGACTAA GAAATAAAGA TGCTTAATTT TATCATACAC GATTAGAGAG GTTCTCAAAC TCTATATAAC 
CCTACATTGG AACACATATA GAGCCACACA CCAATAATTA ATTAGACAAA AGATAAGAGA GAATAGAGAG AGAGAGAGCA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATTGATGGT CCTTGCATAA AGGATATATA TTGTGGAAAA GTAATAATAA TAATATATAT GTGTATGAAT GTCTGTCAAT GTTTTGGATT CAATAAGAAG AAATACCAAA ACCGTTGTGG  ATCAGAAAGA TATGTTTGGA TCGTCCCAAG GTTTCGATGG GATTTTTATT TTTTGTCATT TGTTGGTATA TTTGGTGAGT GATGTCGATA CAACTACCGA TCCGGACATT CGAATATTAG  TTCTAAGTTA TAGTAGTGCC AAACATATAT AAAGCACATC GGTTAGATTA AAAACTAGAT CATAAAACTA AATGATACAT AAATCCAAAA CTTTTTCATT TTTTTCTAAA ATGTCAAGTT  TTTTTAGTTT ATATTTATAA AAAGAAATAG ATATCAACTT CGGGGAATTT AATTAGCTAA TGTCATCAAC TTATTGACTC CAAGGCAAAT CATGATCGTA TTTGTTTTAG TTGTGAGATG  CCAAACGAGT TGGGTACTTT CCCATGTGTC TCCATTGACT CTTTTCACAA TCATTTCCAT TATTATAAGA GCTTTTGATA ATTGGTTTCT ATTTAACCAT CGACGAATAA TTTGGTCAGT  CTCGTCTAGT GTCCAATTGA TAGACATATC TTAGCATTTA TGATTACAAC GAGATAGATC TTGACCTCTA TATTAAAATT CATCATTCAT GTATATTACG ACTAAATTGA TCTTAAGAAG  TTCACATACA TAGTTATGTT TGGCTTTTGA ACAACAGCTG AGATGCTATT GAATTCCTAG GGATAGCTTT CAACTGCTCC ATAATCGTCT ATTTATCTTC TAAGTTAGAT CTAAGAGAGA  TTGTCTTCGT CTTATTAGTT ACCAAATCTA GATTACCTGC AATAGTGCGG ATGATCACCT AACAAAGAAA AAAAAAAAAA AAAAAACTAA TTTGATGGGC TAGACTTTTA AGTAAAAGGC 
CTTAGGAGAG TTGGGCCAAT CTTTGACTAA GCCCCAAGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATGCGAAGCCCTTTTGTCTCCTCGGCTTCTTTTGTCTGTTATTACAGTTATTCTCCATCTTCCATATCGGTAAATACATTCTTCCCTTATCTAATTACGTTATGCCATGTGTC
TCCATTGCCACTCTAATACATTTATCTATAGATACCATATACTGTACTATAAGAAGTAATGATATTCATTCTTTCACTAATTTAATTTCCACCATTAGAATTTAAATATTCTATAAACTA
TTAAAAATTGTAGGAAATGGGGAATTGGAGATGAACTATTACAAAGAGAGTTGTCCAAAAGCGGAAGAGATAATAAGACAACAAGTGGAGACGCTTTACTACAAACACGGTAACACAGCC
GTATCTTGGCTCCGTAATCTCTTCCATGACTGTGTCGTCAAG
GTATATTCACCGGAATTCATAAGACATAGATATCTATACGAGTTTGTCCCCAAAAAAAAATGTCTATATGAATGTTCA
TGTGTGTGTTTTTATTTTATTTTATAGTCGTGTGATGCGTCGCTGCTGCTAGAGACAGCGAGAGGTGTGGAATCTGAGCAGAAATCGAAGAGGAGTTTCGGTATGAGAAACTTTAAGTAC
GTTAAGATTATCAAAGACGCACTCGAGAAAGAGTGTCCTTCCACAGTCTCTTGTGCTGATATTGTCGCTCTTTCTGCGAGAGACGGTATTGTCATG
GTGCGTTTATGCAAATATTTACAT
GCATTTTATTTGGGATTTTTTTTTTTTTGTATTTGTGGTGATTAATTTTTGGTGAAATTAATAGTTGAAAGGGCCAAAGATAGAGATGATAAAGACAGGAAGGAGAGATAGTAGAGGGAG
CTACTTGGGAGATGTTGAGACTCTAATCCCTAACCACAATGACTCTCTCTCATCTGTTATCTCCACCTTTAACTCCATTGGCATCGATGTCGAAGCCACCGTCGCTCTCTTAG
GTAACCA
TGTTTTAACTACTTAAGTAGGATGTCATTTCTGTTTTCCGTTTAGTTCAAGTTTTTTTCGGATAGACAAGAATTTTACTGAATTAAAACCACATTTATCCGGTCGAACTTTTACTAATGT
ATTTAGGGAGTATACTGTAAATTTTTATCTGAATTTTTTTAATTTTGACATACAAAATCGATCACTATAAACGAACTTTTGTTTAGTTATTGGGTTTGGTATTTGATTCGGAGATGTAAT
GTCTAGTGAAGTAAAAAGATATATCACAGAAATTTTCTTAGAGATACTAATTGAATTTCCTTAAATAAGGATGATATCGTTATTTTATTTTATTTTTAATTATAAAATGATATTGTTTTT
TTTTCTTTTTTTAATATAAAATGATATTGTTAGTGATCAGTCAATGTATATAACCGTAGGTGCTCACTCAGTGGGTAGGGTCCACTGCGTTAACCTAGTGCACCGGCTATACCCAACGAT
TGACCCTACTCTCGACCCAAGTTACGCCCTTTACTTAAAAAAACGTTGCCCAAGTCCAACACCGGACCCGAACGCCGTCTTGTACTCCCGTAACGATCGTGAGACTCCGATGGTTGTGGA
CAACATGTATTATAAGAACATCATGGCCCATAAGGGGCTTCTTGTCATTGATGATGAGCTAGCCACCGATCCCAGGACCGCACCGTTTGTGGCCAAGATGGCTGCGGACAATAATTACTT
CCATGAGCAGTTCTCACGTGGCGTCAGGCTCTTGTCCGAGACCAACCCGCTCACGGGAGACCAAGGGGAGATCAGGAAGGATTGTCGTTATGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATGCGAAGCCCTTTTGTCTCCTCGGCTTCTTTTGTCTGTTATTACAGTTATTCTCCATCTTCCATATCGGAAATGGGGAATTGGAGATGAACTATTACAAAGAGAGTTGTCCA
AAAGCGGAAGAGATAATAAGACAACAAGTGGAGACGCTTTACTACAAACACGGTAACACAGCCGTATCTTGGCTCCGTAATCTCTTCCATGACTGTGTCGTCAAG
TCGTGTGATGCGTCG
CTGCTGCTAGAGACAGCGAGAGGTGTGGAATCTGAGCAGAAATCGAAGAGGAGTTTCGGTATGAGAAACTTTAAGTACGTTAAGATTATCAAAGACGCACTCGAGAAAGAGTGTCCTTCC
ACAGTCTCTTGTGCTGATATTGTCGCTCTTTCTGCGAGAGACGGTATTGTCATG
TTGAAAGGGCCAAAGATAGAGATGATAAAGACAGGAAGGAGAGATAGTAGAGGGAGCTACTTGGGA
GATGTTGAGACTCTAATCCCTAACCACAATGACTCTCTCTCATCTGTTATCTCCACCTTTAACTCCATTGGCATCGATGTCGAAGCCACCGTCGCTCTCTTAG
GTGCTCACTCAGTGGGT
AGGGTCCACTGCGTTAACCTAGTGCACCGGCTATACCCAACGATTGACCCTACTCTCGACCCAAGTTACGCCCTTTACTTAAAAAAACGTTGCCCAAGTCCAACACCGGACCCGAACGCC
GTCTTGTACTCCCGTAACGATCGTGAGACTCCGATGGTTGTGGACAACATGTATTATAAGAACATCATGGCCCATAAGGGGCTTCTTGTCATTGATGATGAGCTAGCCACCGATCCCAGG
ACCGCACCGTTTGTGGCCAAGATGGCTGCGGACAATAATTACTTCCATGAGCAGTTCTCACGTGGCGTCAGGCTCTTGTCCGAGACCAACCCGCTCACGGGAGACCAAGGGGAGATCAGG
AAGGATTGTCGTTATGTGAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAACACAT ATAGAGCCAC ACACCAATAA TTAATTAGAC AAAAGATAAG AGAGAATAGA GAGAGAGAGA GCAATGGCCA ATGCGAAGCC CTTTTGTCTC CTCGGCTTCT TTTGTCTGTT  ATTACAGTTA TTCTCCATCT TCCATATCGG AAATGGGGAA TTGGAGATGA ACTATTACAA AGAGAGTTGT CCAAAAGCGG AAGAGATAAT AAGACAACAA GTGGAGACGC TTTACTACAA  ACACGGTAAC ACAGCCGTAT CTTGGCTCCG TAATCTCTTC CATGACTGTG TCGTCAAGTC GTGTGATGCG TCGCTGCTGC TAGAGACAGC GAGAGGTGTG GAATCTGAGC AGAAATCGAA  GAGGAGTTTC GGTATGAGAA ACTTTAAGTA CGTTAAGATT ATCAAAGACG CACTCGAGAA AGAGTGTCCT TCCACAGTCT CTTGTGCTGA TATTGTCGCT CTTTCTGCGA GAGACGGTAT  TGTCATGTTG AAAGGGCCAA AGATAGAGAT GATAAAGACA GGAAGGAGAG ATAGTAGAGG GAGCTACTTG GGAGATGTTG AGACTCTAAT CCCTAACCAC AATGACTCTC TCTCATCTGT  TATCTCCACC TTTAACTCCA TTGGCATCGA TGTCGAAGCC ACCGTCGCTC TCTTAGGTGC TCACTCAGTG GGTAGGGTCC ACTGCGTTAA CCTAGTGCAC CGGCTATACC CAACGATTGA  CCCTACTCTC GACCCAAGTT ACGCCCTTTA CTTAAAAAAA CGTTGCCCAA GTCCAACACC GGACCCGAAC GCCGTCTTGT ACTCCCGTAA CGATCGTGAG ACTCCGATGG TTGTGGACAA  CATGTATTAT AAGAACATCA TGGCCCATAA GGGGCTTCTT GTCATTGATG ATGAGCTAGC CACCGATCCC AGGACCGCAC CGTTTGTGGC CAAGATGGCT GCGGACAATA ATTACTTCCA  TGAGCAGTTC TCACGTGGCG TCAGGCTCTT GTCCGAGACC AACCCGCTCA CGGGAGACCA AGGGGAGATC AGGAAGGATT GTCGTTATGT GAACTAATAT TGATGGTCCT TGCATAAAGG  ATATATATTG TGGAAAAGTA ATAATAATAA TATATATGTG TATGAATGTC TGTCAATGTT TTGGATTCAA TAAGAAGAAA TACCAAAACC GTTGTGGATC AGAAAGATAT GTTTGGATCG  TCCCAAGGTT TCGATGGGAT TTTTATTTTT TGTCATTTGT TGGTATATTT GGTGAGTGAT GTCGATACAA CTACCGATCC GGACATTCGA ATATTAGTTC TAAGTTATAG TAGTGCCAAA 
CATATATAAA GCACATCGGT TAGATTAAAA ACTAGATCAT A 

Retrieve as FASTA