Entry information : PpaPrx02
Entry ID 241
Creation 2008-08-05 (Christophe Dunand)
Last sequence changes 2008-08-05 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx02
Name PpaPrx02
Class Class III peroxidase    [Orthogroup: Prx051]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx02
start..stop
S start..stop
PpaPrx36 386 9e-136 29..317 29..317
PpaPrx52 340 1e-117 5..317 6..316
PpaPrx06 340 1e-117 5..317 6..316
PpaPrx[P]06 288 8e-98 23..280 21..278
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 814463..814684 222 N° 2 813876..814221 346 N° 3 813365..813750 386  
complement(join(813365..813750,813876..814221,814463..814684))


exon

Literature and cross-references PpaPrx02
Literature www.cosmoss.org.
DNA ref. Phytozome 12:   scaffold_46 (814684..813365)
Cluster/Prediction ref. UniGene:   Ppa.7879 [3' end]
Protein sequence: PpaPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (289)
PWM (Da):   %s   35466.12 (32508.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.86 (8.92) Peptide Signal:   %s   cut: 29 range:29-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARILRASCIFALVCVIAISLSVNQVDALDYNYYRKSCPQAESIIFREVQRYFKKDPTVAPGLLRLIFHDCFVRGCDASVLLSGRRSERASAINARLHGFQVIDAAKHYLEDACPRTVSCADILAYASRDAVVLTGGKGWRVIAGRRDGRISNKIEPEQNIPTAFASVNELVSTFAQQGLNTEDMVVLSGAHTIGVTHCNHISDRIYNPVDKTMPKDLLKSLQKSCPKASSPTSLVMDRKSVHKFDTEYFRNIRAGYGLMTSDQGLYREDFTRPIVDANLNQRAFVNRFAEAMFKLQFIQPLEAPDGEIRRRCQCRN

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1 and 3) and 5 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCATTCTTCGAGCCTCGTGTATTTTTGCTTTGGTTTGTGTTATCGCGATATCCCTCAGTGTTAATCAGGTCGACGCTCTTGATTACAACTACTACCGGAAGTCGTGTCCGCAA
GCGGAGAGCATCATTTTCAGGGAGGTTCAGAGATATTTCAAGAAGGATCCGACTGTTGCACCAGGACTGCTCCGCTTGATATTCCATGATTGCTTTGTTCGA
GTAAGTACCTCAGCCTTA
CCCGAAACCAAGAAATAGTATTTAAATCTTGTTCCTTTTCAGTGTCCAGTATGTGAAGTGTGCATTCCAGGTATCGCATTAACGGTTGAAGGGTATGCAATGTGAATACGTAATTTTGTC
TAGCGCTTGAGATTCGATTTCTGTCGTACTCCCACACGTACAACATGGAGTTTGGAATGATCATTCATAGTTTTATTCTGAAATCTTTGTATTCTGTTTACAGGGTTGCGACGCATCTGT
TCTGTTGAGTGGAAGAAGATCTGAAAGGGCGTCCGCAATAAACGCCAGATTGCACGGGTTCCAAGTTATTGACGCCGCGAAACATTATCTTGAGGACGCATGTCCCAGAACAGTGTCCTG
TGCGGATATCTTGGCTTACGCCTCCCGAGACGCAGTGGTCCTCACTGGCGGTAAGGGCTGGAGAGTTATCGCAGGGCGGCGAGATGGGAGAATCTCCAATAAGATAGAGCCCGAGCAAAA
TATTCCTACAGCTTTTGCCAGTGTTAATGAACTGGTTTCTACATTCGCACAGCAGGGATTGAACACGGAAGATATGGTAGTTTTATCTG
GTATATTCTAATTCCTTATCCTTGACAGATC
CTACCGTTATTTTCTCCCATTATCGACCGATTTCTTGTTCGAATGTCAGGTTTGTTCACGGCTGACTTACTGAATTTTGTGATGGTAATTACAGGTGCCCATACAATCGGAGTCACCCAC
TGCAACCATATAAGCGACAGGATATACAACCCGGTCGATAAGACCATGCCCAAGGATCTCCTTAAGTCACTGCAGAAATCATGTCCGAAGGCGTCTTCTCCCACTTCTCTTGTCATGGAT
CGTAAAAGTGTACACAAGTTCGACACCGAGTATTTTAGGAATATCAGAGCTGGCTACGGTCTGATGACTTCTGATCAAGGTCTCTACCGCGAGGACTTCACCCGCCCCATCGTGGACGCA
AATCTGAACCAGCGCGCTTTCGTGAACAGGTTTGCGGAGGCCATGTTCAAGCTCCAATTCATTCAGCCCTTGGAAGCACCTGACGGAGAAATCCGTAGACGGTGCCAGTGTAGGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCATTCTTCGAGCCTCGTGTATTTTTGCTTTGGTTTGTGTTATCGCGATATCCCTCAGTGTTAATCAGGTCGACGCTCTTGATTACAACTACTACCGGAAGTCGTGTCCGCAA
GCGGAGAGCATCATTTTCAGGGAGGTTCAGAGATATTTCAAGAAGGATCCGACTGTTGCACCAGGACTGCTCCGCTTGATATTCCATGATTGCTTTGTTCGA
GGTTGCGACGCATCTGTT
CTGTTGAGTGGAAGAAGATCTGAAAGGGCGTCCGCAATAAACGCCAGATTGCACGGGTTCCAAGTTATTGACGCCGCGAAACATTATCTTGAGGACGCATGTCCCAGAACAGTGTCCTGT
GCGGATATCTTGGCTTACGCCTCCCGAGACGCAGTGGTCCTCACTGGCGGTAAGGGCTGGAGAGTTATCGCAGGGCGGCGAGATGGGAGAATCTCCAATAAGATAGAGCCCGAGCAAAAT
ATTCCTACAGCTTTTGCCAGTGTTAATGAACTGGTTTCTACATTCGCACAGCAGGGATTGAACACGGAAGATATGGTAGTTTTATCTG
GTGCCCATACAATCGGAGTCACCCACTGCAAC
CATATAAGCGACAGGATATACAACCCGGTCGATAAGACCATGCCCAAGGATCTCCTTAAGTCACTGCAGAAATCATGTCCGAAGGCGTCTTCTCCCACTTCTCTTGTCATGGATCGTAAA
AGTGTACACAAGTTCGACACCGAGTATTTTAGGAATATCAGAGCTGGCTACGGTCTGATGACTTCTGATCAAGGTCTCTACCGCGAGGACTTCACCCGCCCCATCGTGGACGCAAATCTG
AACCAGCGCGCTTTCGTGAACAGGTTTGCGGAGGCCATGTTCAAGCTCCAATTCATTCAGCCCTTGGAAGCACCTGACGGAGAAATCCGTAGACGGTGCCAGTGTAGGAACTAG

Retrieve as FASTA