Entry information : PpaPrx04 (Pp1s20_77V6)
Entry ID 242
Creation 2008-08-05 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx04 (Pp1s20_77V6)
Name (synonym) PpaPrx04 (Pp1s20_77V6)
Class Class III peroxidase    [Orthogroup: Prx232]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx04
start..stop
S start..stop
PpaPrx42 416 1e-147 23..318 17..311
MpPrx15 291 4e-98 29..315 25..319
VvPrx39 284 2e-95 11..318 5..322
GbPrx51 284 3e-95 29..318 36..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 505226..505447 222 N° 2 505627..505803 177 N° 3 505989..506546 558  
join(505226..505447,505627..505803,505989..506546)


exon

Literature and cross-references PpaPrx04 (Pp1s20_77V6)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008) In press.
DNA ref. Phytozome 11:   scaffold_20 (505226..506546)
EST ref. GenBank:   FC381388.1 [5' end]
Cluster/Prediction ref. UniGene:   Ppa.17236 [3' end]
Protein sequence: PpaPrx04 (Pp1s20_77V6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (291)
PWM (Da):   %s   33905.33 (31094.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.72 (6.27) Peptide Signal:   %s   cut: 28 range:28-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAALTVRLPLLCILLMCLASVTTIQAQLSTNFYRSTCKDAETIISVAVTSALSRRPAAAAGIIRMLFHDCFVHGCDASVLIDSPSEKDAAPNQSLQGFDVIDEAKAAVEAKCPGIVSCSDVLALAAQISVRLLSDGTITYPVALGRRDGLVSNALLVTGRLPPPTASATTLKLLFKAVGLSTEDMVVLSGAHSIGKARCSFFRNRLTTPSDANMDPDYAESLKRQCPADKPNNLVDLDVTTPTNLDSEYYKNLQVNKGLLTSDQNLQSDPETQPMVSDNAEPGTFRTKFADAIRRMSNIGVLTGSAGEIRLNCRRFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1 and 2) and 8 ESTs. Strain="Villersexel 2003".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGCCCTCACCGTAAGGCTGCCACTTCTGTGTATTCTGCTTATGTGTCTTGCATCTGTGACGACAATACAAGCTCAGCTGAGCACTAACTTCTACCGAAGCACCTGCAAGGAC
GCTGAGACAATCATCTCGGTCGCCGTCACATCGGCATTAAGTAGAAGACCAGCTGCAGCTGCCGGCATTATTCGCATGCTATTCCACGATTGTTTCGTTCAT
GTAAGCTCCTCTACGTCA
CACTCTGAGTATCATATTCTGGTTAAAGGGTTGTCGAATTTGTCACTTGTTTCCACGGCTACTCGAGACTGGTGGACGAACAACTTATCAATTGTCGGAGGTCTTTTTTTTCACTAAGAC
TCGTGATCGTAATTCATATTGGTGTGCAACAATATGTGCAGGGTTGCGATGCATCTGTACTGATCGACTCCCCATCCGAGAAAGATGCCGCGCCCAACCAAAGCCTCCAAGGATTCGACG
TCATTGACGAAGCCAAAGCAGCCGTGGAAGCGAAGTGCCCTGGAATCGTCTCGTGCTCCGACGTTCTTGCTCTGGCCGCTCAAATAAGCGTCAGATTG
GTACAACTCTCAAACTTTCTTT
TCTCGTGAAACATTCAGCTATATTCTCTACTGCTACGACGTCGAGTGATTGAAATCTTTGTTGAACTATTGTGCGCGCAATATTCCTCTGGAGTAATGATTCTGCAAGGATGTAGCGTTG
TAGTTTTTCTGAAACCAGGCCATGTTTGATCAAATCTGCGCAGTTGTCAGATGGGACGATCACATATCCAGTCGCCTTAGGACGCAGGGACGGGCTCGTGTCCAATGCATTGCTCGTAAC
CGGCAGACTGCCCCCACCGACCGCCTCTGCGACCACTCTCAAGTTACTCTTCAAGGCCGTGGGTCTGTCCACGGAGGACATGGTGGTGCTGTCCGGCGCCCACAGCATAGGGAAAGCGCG
ATGCTCCTTCTTCCGAAATCGCCTCACCACTCCCTCTGACGCCAATATGGATCCCGACTACGCCGAGTCGCTGAAGAGGCAGTGCCCCGCAGACAAACCCAACAACCTTGTGGACCTGGA
CGTGACGACGCCCACCAATCTAGACTCGGAGTACTACAAAAACCTGCAGGTCAACAAGGGGCTTCTCACGTCGGATCAGAACCTGCAGAGCGACCCGGAGACACAACCGATGGTCTCAGA
CAATGCCGAGCCGGGTACGTTCCGAACCAAATTCGCAGACGCGATTCGACGCATGAGCAACATTGGCGTGCTCACCGGCAGCGCTGGTGAGATCAGGCTGAACTGCCGCAGGTTCAACTG
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGCCCTCACCGTAAGGCTGCCACTTCTGTGTATTCTGCTTATGTGTCTTGCATCTGTGACGACAATACAAGCTCAGCTGAGCACTAACTTCTACCGAAGCACCTGCAAGGAC
GCTGAGACAATCATCTCGGTCGCCGTCACATCGGCATTAAGTAGAAGACCAGCTGCAGCTGCCGGCATTATTCGCATGCTATTCCACGATTGTTTCGTTCAT
GGTTGCGATGCATCTGTA
CTGATCGACTCCCCATCCGAGAAAGATGCCGCGCCCAACCAAAGCCTCCAAGGATTCGACGTCATTGACGAAGCCAAAGCAGCCGTGGAAGCGAAGTGCCCTGGAATCGTCTCGTGCTCC
GACGTTCTTGCTCTGGCCGCTCAAATAAGCGTCAGATTG
TTGTCAGATGGGACGATCACATATCCAGTCGCCTTAGGACGCAGGGACGGGCTCGTGTCCAATGCATTGCTCGTAACCGGC
AGACTGCCCCCACCGACCGCCTCTGCGACCACTCTCAAGTTACTCTTCAAGGCCGTGGGTCTGTCCACGGAGGACATGGTGGTGCTGTCCGGCGCCCACAGCATAGGGAAAGCGCGATGC
TCCTTCTTCCGAAATCGCCTCACCACTCCCTCTGACGCCAATATGGATCCCGACTACGCCGAGTCGCTGAAGAGGCAGTGCCCCGCAGACAAACCCAACAACCTTGTGGACCTGGACGTG
ACGACGCCCACCAATCTAGACTCGGAGTACTACAAAAACCTGCAGGTCAACAAGGGGCTTCTCACGTCGGATCAGAACCTGCAGAGCGACCCGGAGACACAACCGATGGTCTCAGACAAT
GCCGAGCCGGGTACGTTCCGAACCAAATTCGCAGACGCGATTCGACGCATGAGCAACATTGGCGTGCTCACCGGCAGCGCTGGTGAGATCAGGCTGAACTGCCGCAGGTTCAACTGA

Retrieve as FASTA