Entry information : MgrCIIAB03
Entry ID 2449
Creation 2009-05-25 (Christophe Dunand)
Last sequence changes 2009-05-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrCIIAB03
Name MgrCIIAB03
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation N/D
Tissue type Appressorium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgrCIIAB03
start..stop
S start..stop
CgloCIIAB01_ST23 292 3e-100 8..264 3..260
CgloCIIAB01_Naragc5 291 5e-100 14..264 9..260
ChigCIIAB07 286 5e-98 1..264 1..261
CgraCIIAB07 278 7e-95 1..264 1..262
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11666..12005 340 N° 2 11205..11592 388 N° 3 11071..11137 67  
complement(join(11071..11137,11205..11592,11666..12005))


exon

Literature and cross-references MgrCIIAB03
Literature Dean RA et al.,The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434:980-986(2005).
Protein ref. UniProtKB:   A4QQV5 [Incorrect splicing]
DNA ref. JGI genome:   Supercontig_6.25 (12005..11071)
EST ref. GenBank:   DC963700.1 [3' end]
Cluster/Prediction ref. UniGene:   Mgr.14419
Protein sequence: MgrCIIAB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   264 (238)
PWM (Da):   %s   27891.71 (25337.3)  
PI (pH):   %s   6.48 (6.48) Peptide Signal:   %s   cut: 27 range:27-264
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLASLSSSSLLVASLLFVTAPVPVNGNKLCNPWKPVVADLKASFKGCNADARMAMRAAFHDCFPGSCDGSLILANECNDRPDDNGPLVPICDTLAQKAIDFKVGTADLIQAAGVVAITSCAGPRTYFYVGRKDSSVPSPEGQLPNSESTAQQQIDACKAKGFTTTDLVAMVGAHSAGVSQQGLSFDSTPEKLDSTVFYPETASEKGPTSLQSDYALSNDTQTKTAWKNMGRSNALWRAQFVTTMRKVTLMGNTVKSLTDCSYLI

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 4 ESTs. Strain="70-15". The 3' looks not complete.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCATCACTCTCTAGCTCTTCACTTCTAGTGGCCTCGCTGCTGTTCGTCACAGCGCCAGTGCCCGTCAATGGTAACAAACTCTGCAACCCCTGGAAGCCTGTCGTCGCAGACCTC
AAGGCATCTTTCAAAGGCTGCAATGCCGATGCCAGGATGGCAATGCGTGCAGCCTTCCATGACTGCTTTCCTGGCAGCTGCGACGGGTCATTGATCCTGGCCAACGAATGCAACGATCGT
CCGGATGACAACGGACCTCTTGTGCCTATTTGTGACACTTTGGCACAAAAGGCGATCGACTTCAAGGTCGGCACAGCAGATCTTATACAAGCTGCAGGTG
GTGAGATTTGTCTTGACTGC
GACGTCGCATAGTGATGGGGCCATAACAGCTGAAAATGTTTCCTACCATGTAGTCGTCGCCATCACTTCCTGCGCCGGACCACGCACATACTTCTACGTTGGTCGCAAGGACTCTTCAGT
GCCTAGCCCCGAGGGCCAGCTCCCAAACAGCGAGTCCACTGCCCAGCAGCAGATTGATGCCTGCAAGGCCAAGGGCTTCACGACCACGGACCTCGTCGCCATGGTCGGTGCCCACAGTGC
TGGCGTGAGCCAGCAGGGTCTTTCATTCGACTCGACCCCTGAGAAGCTCGATAGCACCGTTTTTTACCCCGAGACGGCCAGTGAGAAGGGCCCGACGTCGCTGCAGAGTGACTACGCCTT
GAGCAATGATACCCAGACAAAGACCGCCTGGAAGAACATGGGTCGTAGCAATGCTCTTTGGAGGGCGCAGTTTGTTACTAC
GTAAGTCTGCTCGCGATCATGCTTGGTGGAGTGATATGA
GGACGTGGGCTAACCGAGACTCAAACAGTATGCGTAAAGTAACCCTCATGGGCAATACTGTGAAGAGTTTGACGGATTGCAGTTATCTGATATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCATCACTCTCTAGCTCTTCACTTCTAGTGGCCTCGCTGCTGTTCGTCACAGCGCCAGTGCCCGTCAATGGTAACAAACTCTGCAACCCCTGGAAGCCTGTCGTCGCAGACCTC
AAGGCATCTTTCAAAGGCTGCAATGCCGATGCCAGGATGGCAATGCGTGCAGCCTTCCATGACTGCTTTCCTGGCAGCTGCGACGGGTCATTGATCCTGGCCAACGAATGCAACGATCGT
CCGGATGACAACGGACCTCTTGTGCCTATTTGTGACACTTTGGCACAAAAGGCGATCGACTTCAAGGTCGGCACAGCAGATCTTATACAAGCTGCAGGTG
TCGTCGCCATCACTTCCTGC
GCCGGACCACGCACATACTTCTACGTTGGTCGCAAGGACTCTTCAGTGCCTAGCCCCGAGGGCCAGCTCCCAAACAGCGAGTCCACTGCCCAGCAGCAGATTGATGCCTGCAAGGCCAAG
GGCTTCACGACCACGGACCTCGTCGCCATGGTCGGTGCCCACAGTGCTGGCGTGAGCCAGCAGGGTCTTTCATTCGACTCGACCCCTGAGAAGCTCGATAGCACCGTTTTTTACCCCGAG
ACGGCCAGTGAGAAGGGCCCGACGTCGCTGCAGAGTGACTACGCCTTGAGCAATGATACCCAGACAAAGACCGCCTGGAAGAACATGGGTCGTAGCAATGCTCTTTGGAGGGCGCAGTTT
GTTACTAC
TATGCGTAAAGTAACCCTCATGGGCAATACTGTGAAGAGTTTGACGGATTGCAGTTATCTGATATAG

Retrieve as FASTA