Entry information : PpaPrx01
Entry ID 245
Creation 2006-07-28 (Christophe Dunand)
Last sequence changes 2006-07-28
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang Li)
Peroxidase information: PpaPrx01
Name PpaPrx01
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue types Gamete
Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx01
start..stop
S start..stop
PpaPrx05 401 2e-141 1..321 1..319
PabPrx169 315 1e-107 8..321 6..322
PtaPrx53 315 2e-107 4..321 6..322
LuPrx82 311 4e-106 4..321 10..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1139814..1140023 210 N° 2 1139519..1139707 189 N° 3 1139260..1139425 166 N° 4 1138701..1139107 407
complement(join(1138701..1139107,1139260..1139425,1139519..1139707,1139814..1140 023))


exon

Literature and cross-references PpaPrx01
Literature www.cosmoss.org
Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008)
DNA ref. Phytozome 11:   scaffold_104 (1140023..1138701)
Cluster/Prediction ref. UniGene:   Ppa.921
Protein sequence: PpaPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35609.83 (33125.4)  
PI (pH):   %s   7.07 (7.08) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRLAALLIALFCLLATVLKVESEGLVYDYYANSCPNAEKIIHDTVYKLYEKKGNIATSLIRYVFHDCFDSCDASVLLESSKGVPAEKESHSQVGMRNGKWINNIKKAVEDSCPGVVSCADVLALGGAAGAQVLGGPAIKLKTGRKDSRVSLKSVADTGIPTPQSNVSFVLDYFSKMGINTEETVALLGAHTIGRAHCVSFEERIYPTVDPKMDPVFASMLKYRCPQQKTGAEPVHFTYFRNDEQSPMAFDNHYYVNLMANQGLLHIDSEIAWDSRTKLFVVEYAKDNALWHKNFATAFTKLSEHNPLTGTQGEVRKHCSYTL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 29 ESTs. Ecotype="Gransden 2004". No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGGCTGGCTGCTCTTCTGATTGCACTTTTCTGCCTTTTAGCGACAGTTCTGAAGGTGGAATCCGAAGGTCTTGTGTACGATTATTACGCGAACTCTTGTCCCAATGCTGAGAAA
ATCATCCACGACACTGTGTACAAGCTTTACGAGAAGAAGGGCAACATCGCGACTTCCTTGATTCGTTACGTCTTTCATGATTGCTTCGAT
GTAAGATTCCTTTCTGCGCCTAACTTCAAA
TTTGGTGCAACGTCTGATTATATGAATGCAACCTCATTATTCCATGAATTAAACGATGTGTACTTGGCATTCACAGAGCTGCGATGCATCCGTCCTGCTCGAGTCTAGCAAAGGTGTGCC
CGCTGAAAAGGAATCACACTCGCAAGTCGGAATGCGAAACGGGAAGTGGATTAACAATATCAAGAAGGCTGTCGAAGATAGTTGCCCTGGGGTGGTCTCGTGTGCGGATGTCCTCGCCCT
TGGAGGTGCCGCAGGAGCCCAAGTG
GTGAGCCAAGTCTTCATATTCTGAGGATAGCTTCAGATTGTCTACATATATTCCTGTACTCATCTCATTCATCTATTTTGTTTTGCTTTGCAGCT
GGGAGGGCCTGCAATCAAATTGAAAACTGGACGGAAAGATTCTCGTGTCAGTCTAAAGTCGGTAGCTGACACTGGCATACCCACACCTCAAAGCAACGTGTCTTTCGTCCTGGACTATTT
CAGCAAAATGGGAATCAATACCGAAGAGACTGTTGCTCTTCTAG
GTAAATGCTTTTGTGCTTTCATTTGGAAGTCGTTCTTATGGCACTGCCAATCCACAAGATCTATTCTCTCATTGGC
TTTTGAAAATCGTTATGTAGCTGCATTAGACTCAATGGCACTGAACGTCTAGGGTTTACGGCTTGTTATTGAACAGGTGCCCACACGATCGGAAGAGCGCATTGCGTCTCCTTCGAAGAG
AGGATCTACCCCACCGTTGACCCTAAGATGGACCCCGTGTTCGCAAGCATGCTCAAATACCGATGCCCTCAGCAGAAAACAGGGGCAGAGCCGGTGCACTTCACATACTTTCGCAACGAC
GAGCAATCGCCTATGGCGTTTGATAACCATTACTACGTCAATCTGATGGCTAATCAAGGCTTGCTGCACATAGATTCTGAGATTGCTTGGGACTCGAGAACGAAGCTATTCGTAGTGGAG
TACGCCAAGGACAACGCTTTGTGGCACAAGAACTTCGCAACGGCTTTCACCAAGTTGAGTGAACATAATCCTCTGACAGGTACTCAAGGGGAGGTCCGAAAGCATTGTTCTTACACTCTG
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGGCTGGCTGCTCTTCTGATTGCACTTTTCTGCCTTTTAGCGACAGTTCTGAAGGTGGAATCCGAAGGTCTTGTGTACGATTATTACGCGAACTCTTGTCCCAATGCTGAGAAA
ATCATCCACGACACTGTGTACAAGCTTTACGAGAAGAAGGGCAACATCGCGACTTCCTTGATTCGTTACGTCTTTCATGATTGCTTCGAT
AGCTGCGATGCATCCGTCCTGCTCGAGTCT
AGCAAAGGTGTGCCCGCTGAAAAGGAATCACACTCGCAAGTCGGAATGCGAAACGGGAAGTGGATTAACAATATCAAGAAGGCTGTCGAAGATAGTTGCCCTGGGGTGGTCTCGTGTGCG
GATGTCCTCGCCCTTGGAGGTGCCGCAGGAGCCCAAGTG
CTGGGAGGGCCTGCAATCAAATTGAAAACTGGACGGAAAGATTCTCGTGTCAGTCTAAAGTCGGTAGCTGACACTGGCATA
CCCACACCTCAAAGCAACGTGTCTTTCGTCCTGGACTATTTCAGCAAAATGGGAATCAATACCGAAGAGACTGTTGCTCTTCTAG
GTGCCCACACGATCGGAAGAGCGCATTGCGTCTCC
TTCGAAGAGAGGATCTACCCCACCGTTGACCCTAAGATGGACCCCGTGTTCGCAAGCATGCTCAAATACCGATGCCCTCAGCAGAAAACAGGGGCAGAGCCGGTGCACTTCACATACTTT
CGCAACGACGAGCAATCGCCTATGGCGTTTGATAACCATTACTACGTCAATCTGATGGCTAATCAAGGCTTGCTGCACATAGATTCTGAGATTGCTTGGGACTCGAGAACGAAGCTATTC
GTAGTGGAGTACGCCAAGGACAACGCTTTGTGGCACAAGAACTTCGCAACGGCTTTCACCAAGTTGAGTGAACATAATCCTCTGACAGGTACTCAAGGGGAGGTCCGAAAGCATTGTTCT
TACACTCTGTAA

Retrieve as FASTA