Entry information : PpaPrx05 (PP00433G00100)
Entry ID 246
Creation 2008-08-05 (Christophe Dunand)
Last sequence changes 2008-08-05 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: PpaPrx05 (PP00433G00100)
Name (synonym) PpaPrx05 (PP00433G00100)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx05
start..stop
S start..stop
PpaPrx01 401 2e-141 1..319 1..321
PtaPrx53 275 5e-92 1..321 1..324
AcvPrx02 273 6e-91 23..321 27..329
EsinPrx07 271 2e-90 14..321 20..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 122921..123136 216 N° 2 122638..122826 189 N° 3 122362..122524 163 N° 4 121844..122241 398
complement(join(121844..122241,122362..122524,122638..122826,122921..123136))


exon

Literature and cross-references PpaPrx05 (PP00433G00100)
Literature Richardson,P., Lucas,S., Rokhsar,D., Wang,M. and Lindquist,E.A. DOE Joint Genome Institute Physcomitrella patens EST project Unpublished (2007).
DNA ref. Phytozome 12:   scaffold_433 (123136..121844)
EST ref. GenBank:   FC435111.1 [5' end]   BJ609729.1 [3' end]
Cluster/Prediction ref. UniGene:   Phypa1_1.11153
Protein sequence: PpaPrx05 (PP00433G00100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (296)
PWM (Da):   %s   35761.25 (33240.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.95 (10.02) Peptide Signal:   %s   cut: 26 range:26-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARLGSFVAVLVLVCAASFVNVADSAGLVNNFYRKSCPNAEKIIRDSIYRMYEKKGNIATSFIRFGFHDFFNGADASFFLLSAPGKTSEKDSHSMVGMRNEKYVNNIKAEVEKVCPGVVSCADILAVGSAAAVQVLGGPYIHVKTGRKDTRNSMKSSADTIPRPQDGVTKVLTFYKNIGINPREAVALMGAHTIGRAHCTSFIERIFPKVDPKMDPVFAEKLKRRCPAKPTSVHFTYFRNDEPSPMAFDNNYFKNLVTKQGLMGIDSALYWDGRTQKYVIEFSQNEAAWREVFTVAFKKLSEYKVLTGRQGEIRKRCMYVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 23 ESTs. BJ174364/ BJ579514 , BJ204924/BJ601851 (same clone, 5' and 3'ends). Strain="Gransden 2004". Missing 'c'. containing motif fhdf.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTTTGGGATCCTTCGTTGCTGTACTGGTCCTCGTGTGTGCGGCGAGTTTCGTCAATGTAGCTGATTCGGCCGGGCTAGTAAACAACTTTTACAGAAAATCATGCCCCAATGCT
GAGAAAATCATCCGCGACAGCATTTACAGAATGTACGAGAAAAAAGGAAACATCGCCACTTCCTTCATTCGATTCGGCTTCCACGACTTCTTTAAT
GTAAGTTCTGCCTTCCACACGATC
ACGCCGACATCGCGACATCTGTAATGTGGTCTGATTTGTTTCTAATTGTACCGGCTCTCCTATCTTGCAGGGCGCCGACGCGTCTTTCTTTCTCCTGTCAGCTCCAGGCAAAACTTCGGA
GAAAGACTCTCACTCGATGGTAGGCATGAGGAACGAGAAATATGTCAATAACATCAAGGCCGAAGTTGAGAAAGTATGCCCAGGAGTCGTGTCTTGCGCTGACATTCTCGCAGTTGGCTC
AGCTGCCGCTGTGCAAGTG
GTACGGAATCTGAGCGCTTTTTCATTTAGGAATTCAATTAAGGCATTGTATCCATAATAACTTCTGCTGGATCGCTATGCTGATTCTCTTATGTATTTGGG
TAAAATTTGCAGTTAGGAGGACCTTACATCCACGTGAAGACTGGACGAAAGGACACCCGCAACAGCATGAAGTCATCCGCAGATACGATCCCCCGCCCCCAGGACGGTGTCACCAAGGTC
TTGACATTCTATAAGAACATTGGGATCAACCCTCGAGAGGCGGTCGCTCTTATGG
GTGAGTAGGCTTGCCTTCGAACCTAGCGAATATAATCGATCGCTCAGGATTATTCAGATTCTATC
ACAATTGTATTATCTTTTGGGTTCTAGTTCTGATGTGCCACTATAATGTGCGCAGGAGCTCACACTATCGGAAGAGCCCACTGCACAAGTTTCATTGAACGTATTTTCCCTAAGGTAGAC
CCCAAGATGGACCCGGTATTCGCCGAGAAGCTGAAGCGTAGATGCCCTGCCAAACCTACAAGTGTCCATTTCACGTACTTCCGCAACGATGAGCCGTCTCCGATGGCGTTCGACAACAAC
TACTTCAAGAACCTTGTAACCAAGCAAGGCTTGATGGGGATCGACTCCGCTCTCTATTGGGACGGAAGAACCCAAAAATACGTCATTGAATTTAGTCAAAATGAAGCTGCCTGGAGAGAA
GTCTTCACGGTAGCATTCAAGAAGCTGAGCGAGTACAAGGTTCTCACAGGCAGGCAGGGCGAAATCCGCAAGAGGTGTATGTATGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTTTGGGATCCTTCGTTGCTGTACTGGTCCTCGTGTGTGCGGCGAGTTTCGTCAATGTAGCTGATTCGGCCGGGCTAGTAAACAACTTTTACAGAAAATCATGCCCCAATGCT
GAGAAAATCATCCGCGACAGCATTTACAGAATGTACGAGAAAAAAGGAAACATCGCCACTTCCTTCATTCGATTCGGCTTCCACGACTTCTTTAAT
GGCGCCGACGCGTCTTTCTTTCTC
CTGTCAGCTCCAGGCAAAACTTCGGAGAAAGACTCTCACTCGATGGTAGGCATGAGGAACGAGAAATATGTCAATAACATCAAGGCCGAAGTTGAGAAAGTATGCCCAGGAGTCGTGTCT
TGCGCTGACATTCTCGCAGTTGGCTCAGCTGCCGCTGTGCAAGTG
TTAGGAGGACCTTACATCCACGTGAAGACTGGACGAAAGGACACCCGCAACAGCATGAAGTCATCCGCAGATACG
ATCCCCCGCCCCCAGGACGGTGTCACCAAGGTCTTGACATTCTATAAGAACATTGGGATCAACCCTCGAGAGGCGGTCGCTCTTATGG
GAGCTCACACTATCGGAAGAGCCCACTGCACA
AGTTTCATTGAACGTATTTTCCCTAAGGTAGACCCCAAGATGGACCCGGTATTCGCCGAGAAGCTGAAGCGTAGATGCCCTGCCAAACCTACAAGTGTCCATTTCACGTACTTCCGCAAC
GATGAGCCGTCTCCGATGGCGTTCGACAACAACTACTTCAAGAACCTTGTAACCAAGCAAGGCTTGATGGGGATCGACTCCGCTCTCTATTGGGACGGAAGAACCCAAAAATACGTCATT
GAATTTAGTCAAAATGAAGCTGCCTGGAGAGAAGTCTTCACGGTAGCATTCAAGAAGCTGAGCGAGTACAAGGTTCTCACAGGCAGGCAGGGCGAAATCCGCAAGAGGTGTATGTATGTT
AATTAA

Retrieve as FASTA