Entry information : PpaPrx06
Entry ID 247
Creation 2006-07-26 (Christophe Dunand)
Last sequence changes 2012-01-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Qiang Li)
Peroxidase information: PpaPrx06
Name PpaPrx06
Class Class III peroxidase    [Orthogroup: Prx051]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx06
start..stop
S start..stop
PpaPrx52 660 0 1..316 1..316
PpaPrx[P]06 422 2e-150 1..280 1..279
PpaPrx36 396 1e-139 25..316 26..317
PpaPrx02 340 1e-117 6..316 5..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 950219..950437 219 N° 2 950724..951455 732  
join(950219..950437,950724..951455)


exon

Literature and cross-references PpaPrx06
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
www.cosmoss.org
DNA ref. Phytozome 12:   scaffold_114 (950219..951455)
Cluster/Prediction ref. UniGene:   Ppa.4596
Protein sequence: PpaPrx06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (290)
PWM (Da):   %s   34660.81 (32032.4) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.4 (8.40) Peptide Signal:   %s   cut: 27 range:27-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHHAMRATVIAVVLVAMLAVTGVDATLRYGFYKHSCPNVESIIYKAMKAAYEKDNTVAPGVLRLIFHDCFVRGCDASVLLAGNNTERAALNNQGLHGFEAIDAVKDAVEKECPGVVSCADILAFASRDTVILTKGVGWEVPAGRMDGRISLSTEPLQELPPSTFTSQQLISIFAGKGLTAKQMVDLSGSHTLGITHCLHLRDRIFTTIDPTIPKNLLRQLQRKCPSNTSLTPLQIDRYTGNKFDTQYFRNIVRGRGLMTSDQDLFRDPATKPFVEANLKRATFDKNFAEAMVAMTSIEVKIGHEGEIRKHCQFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1) and 28 ESTs. Tandem duplication of same sequence.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCATCACGCGATGAGGGCCACTGTAATAGCCGTCGTGTTGGTCGCCATGTTGGCCGTGACTGGTGTTGATGCTACGCTGAGGTATGGCTTCTACAAGCACTCGTGCCCTAATGTG
GAGAGCATCATTTACAAGGCGATGAAGGCGGCATATGAGAAAGACAATACAGTTGCTCCTGGCGTTCTCCGCCTCATCTTTCATGACTGCTTCGTTCGG
GTACGCATGCAGCTGAATATT
CAAGNNNNNNNNNNNNNNNNNNNNNNGATATTTGTTTCTTTAGGGTCAATATGCCGCATTAGAGTGGAATTGGTTTAAGGCGGTTCTTTTCTTCGCACCGTGAAGCTCATCACACTGGGG
TCGCTGATTCAGAGATATACACATTACAATGCCTGACTCCAAATGTGCACTTTTGACGTGAATCTATTTTCGCGAGCGAGATTGAGGCGAGATCCCGATCATAGAGATCGATACATTGCA
TTGATGGATCTCATAATGGCTGCAGGGCTGTGATGCCTCCGTCCTTCTGGCTGGAAATAACACAGAGAGAGCTGCCCTGAATAACCAAGGCTTGCACGGGTTCGAGGCCATCGATGCTGT
TAAGGACGCAGTCGAGAAAGAATGCCCCGGAGTGGTCTCATGCGCAGACATCCTCGCCTTCGCTTCTCGTGACACAGTGATCCTGACTAAAGGAGTGGGCTGGGAAGTCCCCGCAGGACG
GATGGACGGCAGAATTTCTCTCTCCACAGAGCCTCTTCAGGAGCTGCCTCCATCAACATTCACTAGCCAGCAGCTAATATCCATATTTGCTGGCAAGGGACTGACCGCAAAACAGATGGT
TGATCTCTCCGGTTCTCACACCCTCGGAATCACCCACTGCCTTCATCTGCGCGACAGGATTTTCACCACCATAGACCCAACTATCCCGAAGAACCTACTCAGGCAGCTGCAGCGCAAGTG
TCCCAGTAACACCTCCCTCACTCCCTTGCAGATCGACCGCTACACCGGAAATAAGTTCGACACCCAGTACTTCAGAAACATCGTCAGGGGACGCGGCCTCATGACCTCAGACCAGGATCT
GTTCAGAGACCCAGCGACGAAACCTTTTGTGGAGGCTAACCTTAAAAGAGCCACATTCGACAAGAACTTCGCTGAGGCGATGGTGGCGATGACTAGCATCGAGGTAAAGATTGGACACGA
GGGGGAGATCAGAAAGCACTGCCAGTTCGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCATCACGCGATGAGGGCCACTGTAATAGCCGTCGTGTTGGTCGCCATGTTGGCCGTGACTGGTGTTGATGCTACGCTGAGGTATGGCTTCTACAAGCACTCGTGCCCTAATGTG
GAGAGCATCATTTACAAGGCGATGAAGGCGGCATATGAGAAAGACAATACAGTTGCTCCTGGCGTTCTCCGCCTCATCTTTCATGACTGCTTCGTTCGG
GGCTGTGATGCCTCCGTCCTT
CTGGCTGGAAATAACACAGAGAGAGCTGCCCTGAATAACCAAGGCTTGCACGGGTTCGAGGCCATCGATGCTGTTAAGGACGCAGTCGAGAAAGAATGCCCCGGAGTGGTCTCATGCGCA
GACATCCTCGCCTTCGCTTCTCGTGACACAGTGATCCTGACTAAAGGAGTGGGCTGGGAAGTCCCCGCAGGACGGATGGACGGCAGAATTTCTCTCTCCACAGAGCCTCTTCAGGAGCTG
CCTCCATCAACATTCACTAGCCAGCAGCTAATATCCATATTTGCTGGCAAGGGACTGACCGCAAAACAGATGGTTGATCTCTCCGGTTCTCACACCCTCGGAATCACCCACTGCCTTCAT
CTGCGCGACAGGATTTTCACCACCATAGACCCAACTATCCCGAAGAACCTACTCAGGCAGCTGCAGCGCAAGTGTCCCAGTAACACCTCCCTCACTCCCTTGCAGATCGACCGCTACACC
GGAAATAAGTTCGACACCCAGTACTTCAGAAACATCGTCAGGGGACGCGGCCTCATGACCTCAGACCAGGATCTGTTCAGAGACCCAGCGACGAAACCTTTTGTGGAGGCTAACCTTAAA
AGAGCCACATTCGACAAGAACTTCGCTGAGGCGATGGTGGCGATGACTAGCATCGAGGTAAAGATTGGACACGAGGGGGAGATCAGAAAGCACTGCCAGTTCGTGAACTAG

Retrieve as FASTA