Entry information : PpaAPx02 (PP00424G00210)
Entry ID 2497
Creation 2010-02-10 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-23 (Marcel Zamocky)
Peroxidase information: PpaAPx02 (PP00424G00210)
Name (synonym) PpaAPx02 (PP00424G00210)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation Thylakoid-bound
Tissue type Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaAPx02
start..stop
S start..stop
CroAPx04 513 0 88..437 97..441
BoAPx04_other 510 0 87..437 84..427
ZmaAPx03 509 0 91..437 83..425
ThasAPx08 509 1e-180 69..437 54..416
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 212264..213017 754 N° 2 213149..213717 569  
join(212264..213017,213149..213717)


exon

Literature and cross-references PpaAPx02 (PP00424G00210)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 11:   scaffold_424 (212264..213717)
Cluster/Prediction ref. UniGene:   Ppa.14642
Protein sequence: PpaAPx02 (PP00424G00210)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   440
PWM (Da):   %s   48166.69 Transmb domain:   %s   o417-439i
PI (pH):   %s   8.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSASSVLGLGSTGVVSVQIASSSSCSSRSAPSEAASLGFATRRRAAACSETTSQLRSEFLPSLSPVKKSIKFAASRKGPFASLNVRAIASDPAQLRSAREDIKTLLREDPCHPILIRLGWHDAGTYDKNIKEWPLRGGANGSIRYDIELSHKANAGLINALKLLESTKQKYPDITYADLFQLASATAIEEAGGPKIPLRYGRKDVSGPDQCVKEGNLPDADPKPTPPADHLRKVFYRMDLNDQDIVALSGAHTLGRVHPERSGFGQKETKYTKNGPGKPGGSSWTPEWLKFDNSYFREIKEKRDADLVVLPTDAVLFEDPEFKKYAEKYATDREAFFNDYAISHAKLSEIGAEFDPPQGFFLDKPEKKDEPEVFVASKYSTQPEAKQELSDNMKDKIRAEYLAIGGSPNKAMGSNYFLNIIIGISVLVLLSYYLGYLG

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 214 ESTs. UniGene entry retired in 2016!
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTTCGGCTTCCTCAGTGCTGGGGTTAGGAAGCACAGGGGTGGTGAGTGTGCAAATAGCTTCGTCGTCGTCGTGTTCATCGCGTTCTGCTCCTTCTGAGGCTGCTTCTTTGGGG
TTTGCAACAAGGAGAAGAGCAGCGGCGTGTTCCGAAACTACTTCCCAGCTTCGGTCTGAGTTTCTTCCGAGCCTCTCACCAGTTAAGAAGTCCATTAAGTTTGCGGCGTCAAGGAAAGGT
CCTTTTGCTTCTCTTAATGTGCGCGCCATAGCCTCTGATCCGGCCCAGCTGAGATCTGCCCGCGAGGACATCAAGACTCTTCTCCGGGAGGATCCTTGTCACCCAATTTTGATCCGTTTG
GGCTGGCACGACGCAGGGACTTATGACAAGAATATTAAAGAGTGGCCCCTCCGAGGTGGCGCCAATGGAAGCATCAGATATGACATTGAGCTCAGCCACAAGGCAAATGCAGGCCTCATC
AATGCCCTCAAGCTGCTTGAGTCCACAAAGCAGAAGTATCCAGACATCACTTATGCGGACCTGTTTCAGCTCGCAAGTGCCACTGCCATTGAGGAAGCCGGGGGCCCTAAAATCCCGCTT
CGTTATGGACGCAAAGATGTCTCTGGCCCCGATCAGTGTGTGAAGGAGGGCAATCTTCCCGATGCTGACCCCAAACCTACTCCCCCTGCTGACCACCTGCGCAAGGTTTTCTACAGGATG
GACTTGAACGACCAAGATATTGTCGCTCTCTCAG
GTATGCATTTGAATGCCCTTTCTCACACTTCGTTTTGGGAATTAGGTTAGTGAAATCTCCTGCACTGTTTCTTCTGCTCTTTTTAG
TACTCTATTACTGACGATTTCACTGCGCGATTTTATCTTCCTCAGGTGCACATACTCTAGGAAGGGTTCACCCAGAACGCAGTGGATTCGGGCAGAAAGAAACCAAGTACACTAAGAACG
GGCCAGGCAAACCAGGAGGTTCCTCATGGACGCCTGAGTGGCTGAAATTTGACAACTCCTACTTCAGGGAGATTAAGGAGAAGCGAGACGCGGACCTTGTGGTTTTGCCTACGGACGCCG
TCTTGTTCGAAGACCCTGAATTCAAGAAATACGCTGAGAAGTACGCCACAGACAGGGAGGCATTTTTCAACGACTACGCCATCTCTCACGCTAAGCTCAGCGAAATCGGTGCCGAATTTG
ATCCTCCACAAGGCTTCTTCCTCGATAAGCCTGAGAAGAAGGACGAGCCCGAGGTTTTTGTGGCATCCAAATACTCCACGCAACCGGAAGCGAAGCAAGAACTCTCGGACAACATGAAGG
ACAAGATCCGCGCCGAGTATTTAGCTATCGGGGGTTCTCCTAACAAGGCTATGGGCTCCAACTACTTCCTCAACATAATTATTGGCATTTCGGTGCTTGTTCTCTTATCTTACTATCTGG
GATATCTTGGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTTCGGCTTCCTCAGTGCTGGGGTTAGGAAGCACAGGGGTGGTGAGTGTGCAAATAGCTTCGTCGTCGTCGTGTTCATCGCGTTCTGCTCCTTCTGAGGCTGCTTCTTTGGGG
TTTGCAACAAGGAGAAGAGCAGCGGCGTGTTCCGAAACTACTTCCCAGCTTCGGTCTGAGTTTCTTCCGAGCCTCTCACCAGTTAAGAAGTCCATTAAGTTTGCGGCGTCAAGGAAAGGT
CCTTTTGCTTCTCTTAATGTGCGCGCCATAGCCTCTGATCCGGCCCAGCTGAGATCTGCCCGCGAGGACATCAAGACTCTTCTCCGGGAGGATCCTTGTCACCCAATTTTGATCCGTTTG
GGCTGGCACGACGCAGGGACTTATGACAAGAATATTAAAGAGTGGCCCCTCCGAGGTGGCGCCAATGGAAGCATCAGATATGACATTGAGCTCAGCCACAAGGCAAATGCAGGCCTCATC
AATGCCCTCAAGCTGCTTGAGTCCACAAAGCAGAAGTATCCAGACATCACTTATGCGGACCTGTTTCAGCTCGCAAGTGCCACTGCCATTGAGGAAGCCGGGGGCCCTAAAATCCCGCTT
CGTTATGGACGCAAAGATGTCTCTGGCCCCGATCAGTGTGTGAAGGAGGGCAATCTTCCCGATGCTGACCCCAAACCTACTCCCCCTGCTGACCACCTGCGCAAGGTTTTCTACAGGATG
GACTTGAACGACCAAGATATTGTCGCTCTCTCAG
GTGCACATACTCTAGGAAGGGTTCACCCAGAACGCAGTGGATTCGGGCAGAAAGAAACCAAGTACACTAAGAACGGGCCAGGCAAA
CCAGGAGGTTCCTCATGGACGCCTGAGTGGCTGAAATTTGACAACTCCTACTTCAGGGAGATTAAGGAGAAGCGAGACGCGGACCTTGTGGTTTTGCCTACGGACGCCGTCTTGTTCGAA
GACCCTGAATTCAAGAAATACGCTGAGAAGTACGCCACAGACAGGGAGGCATTTTTCAACGACTACGCCATCTCTCACGCTAAGCTCAGCGAAATCGGTGCCGAATTTGATCCTCCACAA
GGCTTCTTCCTCGATAAGCCTGAGAAGAAGGACGAGCCCGAGGTTTTTGTGGCATCCAAATACTCCACGCAACCGGAAGCGAAGCAAGAACTCTCGGACAACATGAAGGACAAGATCCGC
GCCGAGTATTTAGCTATCGGGGGTTCTCCTAACAAGGCTATGGGCTCCAACTACTTCCTCAACATAATTATTGGCATTTCGGTGCTTGTTCTCTTATCTTACTATCTGGGATATCTTGGC
TAG

Retrieve as FASTA