Entry information : PpaAPx03 (PP00021G00500)
Entry ID 2498
Creation 2007-02-12 (Felipe Teixeira)
Last sequence changes 2007-02-12 (Felipe Teixeira)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaAPx03 (PP00021G00500)
Name (synonym) PpaAPx03 (PP00021G00500)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation Peroxisomal
Tissue type Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaAPx03
start..stop
S start..stop
SmAPx02-1_0 474 5e-171 1..297 1..295
SmAPx02-2_60 474 5e-171 1..297 1..295
HaAPx03 437 8e-157 1..297 1..283
LsaAPx02 437 2e-156 1..297 1..283
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 628117..628229 113 N° 2 627319..627443 125 N° 3 627117..627166 50 N° 4 626881..626946 66
N° 5 626693..626741 49 N° 6 626434..626516 83 N° 7 626256..626335 80 N° 8 625769..625871 103
N° 9 625311..625544 234  
complement(join(625311..625544,625769..625871,626256..626335,626434..626516,6266 93..626741,626881..626946,627117..627166,627319..627443,628117..628229))


exon

Literature and cross-references PpaAPx03 (PP00021G00500)
DNA ref. Phytozome 12:   scaffold_21 (628229..625311)
mRNA ref. JGI transcript:   177021 [Incorrect splicing]
Cluster/Prediction ref. UniGene:   Ppa.6447
Protein sequence: PpaAPx03 (PP00021G00500)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   300
PWM (Da):   %s   32523.56 Transmb domain:   %s   o270-292i
PI (pH):   %s   7.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPAPVVDDEYKTCIEKARRDLRAFIAEKNCAPLMLRLAWHDAGTYDASTRTGGPNGSIRSEREYTHGANNGLKIAIDFEAMKSKYPVITYADLYLAGVVAVEVTGGPTIEFVAGRKDSVATPPEGRLPDAKKGPSHLKDIFYRMGLSDRDIVALSGGHTGRAHKDRSGFEGPWTSNPLKFDNTYFQELLRGGSDGLLLLPTDKALLEDPAFKPWVELYADEDAFFRDYAVSHKKLSELGCKDTSPAFSTQSANSKSAVEAYQSSTAVLGQAAVGVGVAAAVVVLSYIYEAKRKILK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns and 1 extra introns in the 5'UTR) and 70 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGCTCCAGTGGTTGACGATGAGTACAAGACGTGTATAGAGAAGGCTCGCCGGGACCTACGAGCTTTCATAGCTGAGAAGAACTGTGCTCCTCTCATGCTCCGCCTTGCGTACGGT
GTCTTAACCTTTTGATGTATTGACGACCAAATTGGCGCATGATTACCGTTTGACAACCTCGTTAGTCTGGACTTGAGGCTTGTGACGCTCTGAGTAGAAATCTCCTCTTCTCTTTCGCTG
TTTCGTAGCCTAATATGCCTTTCTCTCGCAGCTGGAACAGAGTACTACTGCCGTAATTTACAGTGTTTTCCCTGTTCGTAACTTTGGTCCACACCTTCTCGACGAGGATTGTAATGATTA
GCTCTTGTATCCTAGTAGCAATGCAGAAAGATTAAATTCATTTTTTCGAGTGGTTGCACTTCAACAACCAATTTAAGTTCATAGATTTTACTTCGTTCTCTCTTTCTTTTGTCTATAAAA
ATTCTAAGTAGTTGGGAGTTGAACTCTGGTTATTTTGTTGGAACAAACAGATACAAACTTTATTGCACTTGCTGCTAGCTATTGTTGGCTTTCTTTCAAACCAGATCTGTGGAAGCTTTA
TGTAAGATTTCTGCAACGGAATTATTTGGCAGTGTTTAGGGTCCGATGACATCATTACCATGTCTTCTTCTTAACTACATCCGAAATTAAGATTTGAACTTTTAATTCTGACGAGCTGTG
AGCACGTAATTACGTTGGGACTTTTTTTTGTTGTAGTTCTTAATTTTACAATGATACATTGTGTAGGTGGCATGATGCTGGCACGTATGACGCAAGCACTAGGACTGGAGGTCCGAACGG
TTCCATTCGTAGCGAGCGCGAGTATACCCATGGAGCAAACAATGGCCTTAAAATTGCCATAGATTTTTGCG
GTAATGAGAACCATTTGTACACTGTTTGAAGTGTTTACACGAATGTGTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGACTTGAACACAATGTTTTGTATCTTAGCCCAGGTGTCTGATGAGTTGTTTTTGTTTTTTGGGGTAACAGAAGCCATGAAATCGAAG
TACCCTGTCATCACATACGCGGATCTTTACCAG
GTTATCTTTCTGATCTTTTCTCTAGGTTTGGAGCATATCAAGTTTCTGCTACGATGCATATGTAGCTACACTCGGATCGCACATCAT
GGGATGATGTTAAAAAATTTCACTAATTTGTTTTCAATTCTCATACGCTTTGTCTGAGATTTCTCTATGACTATGTCGTGCAGCTCGCAGGCGTGGTGGCTGTTGAAGTAACTGGAGGTC
CAACTATTGAGTTTGTTGCTGGGCGCAAG
GTAACTCCATACCTTAAGTGATTGTTACTTTTTAATTTGTGATCCAGTGGACAAGTGCACGAGGTAGGAGTATTTATTTTTTGAAATTCAG
GGGGAACCCATGGTTTTGAAATGTAGGTGCAACTTTTTTTGATTGCAGGATTCAGTTGCCACTCCACCCGAAGGGAGATTGCCCGATGCCAAAAAAGGTATGTGAATCGTGTATTGGTTC
GATATCTTAGTCACCAGGTTGTTCGTTATAGTACTTTACCGGTTCCTGACTTAAGTTTTCAAAATGGTCAATATCTAGCAAACATCAGGCTTTTATAACGTTTCGAGCTGTAAATTTCTT
CGTCATACGATTTGTCATATTCTTGTCAAGCAGGACCCTCGCATCTGAAAGATATCTTCTATCGCATGGGACTGTCCGACAGAGACATAGTTGCTTTGTCTGGGGGTCACACTTTGGTAA
TTAACTAAACCTTGACAGCTTTGACATGTGTTCTTTAGATACATTGATACATAATCATGGGTGTTGATGCTAATTGGATGTCTATGAAATGCAGGGAAGAGCTCACAAGGATAGATCTGG
ATTTGAAGGTCCATGGACATCCAACCCACTCAAATTTGACAACACTTACTTTCA
GTAAGTAATCTCTAATGATGAGTGAGGGTCAAGTTTTGGTCATTGTATCGATTGCAGACAAGTGGC
ATGAAAGTACTTTGTCTGCAAGCATTCGAAGCGTGGATGACTGCTCATTTGGACGTTGCTTCCTCTCGGTTTGTTAGAAACAAGAACATATTCGTTCTTGGTAGTGGATAGCAGTGTTTT
AGACAGTGTGTGAATGCCGAGATGAATGTTGGCTAGTTTTGTTCCCAGCTTGTGTATGCAGCATAGTCTGAATTTTGGACCGTCTTTTCTGTACTTGTTCTTTGTAAGTCTGCTTAATGG
AGACAGGAGGATATTAGTCAGCTCTCACGACTCTTTTAACTTTTCGGATGTGACTAAAACCTAGATGGTTATGTGCAGGGAATTACTGAGGGGAGGGTCAGATGGCCTCTTGCTCTTGCC
CACAGACAAGGCATTATTGGAGGACCCTGCTTTTAAGCCATGGGTGGAGCTTTATGCCAGG
GTAAACTTCCTTTTTTAACTTTACTTGGTCTTTAGTATTTTGCAACTAGCTACCCCTCG
GTGTACGTGGTTTTTAGATTATCCTTGAAGTGCGTCCTTCGTTGTTTTGGTACTGTAACTTTTGCAAGTTGGTGAGGGTTTGTTACTTTACCATGTTTTCTGTTTAGACAATATGTTTAA
AAATGTATCTGTGTGATTGAATGACTATTTATAATCATATTACAGGATGAGGATGCTTTCTTCCGTGATTATGCTGTATCTCATAAGAAGCTATCTGAGTTGGGCTGCAAAGACACCTCT
CCTGCTTTCTCAACTCAGTCTGCCAACAGCAAATCAGCGGTAGAAGCTTATCAAAGTTCAACTGCCGTCCTTGGACAAGCTGCCGTTGGTGTGGGAGTTGCAGCTGCGGTTGTCGTGCTA
AGTTACATCTACGAGGCCAAGCGCAAAATCCTCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGCTCCAGTGGTTGACGATGAGTACAAGACGTGTATAGAGAAGGCTCGCCGGGACCTACGAGCTTTCATAGCTGAGAAGAACTGTGCTCCTCTCATGCTCCGCCTTGCGTGGCAT
GATGCTGGCACGTATGACGCAAGCACTAGGACTGGAGGTCCGAACGGTTCCATTCGTAGCGAGCGCGAGTATACCCATGGAGCAAACAATGGCCTTAAAATTGCCATAGATTTTTGCG
AA
GCCATGAAATCGAAGTACCCTGTCATCACATACGCGGATCTTTACCAG
CTCGCAGGCGTGGTGGCTGTTGAAGTAACTGGAGGTCCAACTATTGAGTTTGTTGCTGGGCGCAAGGATTCA
GTTGCCACTCCACCCGAAGGGAGATTGCCCGATGCCAAAAAAG
GACCCTCGCATCTGAAAGATATCTTCTATCGCATGGGACTGTCCGACAGAGACATAGTTGCTTTGTCTGGGGGTCAC
ACTTTG
GGAAGAGCTCACAAGGATAGATCTGGATTTGAAGGTCCATGGACATCCAACCCACTCAAATTTGACAACACTTACTTTCAGGAATTACTGAGGGGAGGGTCAGATGGCCTCTTG
CTCTTGCCCACAGACAAGGCATTATTGGAGGACCCTGCTTTTAAGCCATGGGTGGAGCTTTATGCCAGG
GATGAGGATGCTTTCTTCCGTGATTATGCTGTATCTCATAAGAAGCTATCT
GAGTTGGGCTGCAAAGACACCTCTCCTGCTTTCTCAACTCAGTCTGCCAACAGCAAATCAGCGGTAGAAGCTTATCAAAGTTCAACTGCCGTCCTTGGACAAGCTGCCGTTGGTGTGGGA
GTTGCAGCTGCGGTTGTCGTGCTAAGTTACATCTACGAGGCCAAGCGCAAAATCCTCAAGTAA

Retrieve as FASTA