Entry information : MgCP01 (MgKatG1)
Entry ID 2538
Creation 2005-11-15 (Filippo Passardi)
Last sequence changes 2012-04-24 (Filippo Passardi)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Christophe Dunand)
Peroxidase information: MgCP01 (MgKatG1)
Name (synonym) MgCP01 (MgKatG1)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella graminicola (Septoria tritici)    [TaxId: 54734 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgCP01
start..stop
S start..stop
AmacrCP02 1191 0 6..751 4..744
MbicCP02 1178 0 6..751 4..751
MvarCP02 1174 0 6..751 4..752
ZcelCP01 1165 0 1..741 1..744
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 924636..924703 68 N° 2 922385..924572 2188  
complement(join(922385..924572,924636..924703))


exon

Literature and cross-references MgCP01 (MgKatG1)
Literature Keon,J.P.R., Hargreaves,J.A., Antoniw,J.F. and Hammond-Kosack,K.Analysis of expressed sequence tags from the wheat fungal leaf blotch pathogen, Mycosphaerella graminicola (anamorph Septoria tritici) Fungal Genet. Biol. (2004)
Protein ref. UniProtKB:   F9XH87
DNA ref. JGI genome:   chr_8 (924703..922385)
EST ref. GenBank:   AJ639278.1 [Fragment]
Cluster/Prediction ref. JGI gene:   105409
Protein sequence: MgCP01 (MgKatG1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   751
PWM (Da):   %s   82366.03  
PI (pH):   %s   6.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSANGCPIKLANVGGGGTRNRDWWPNELNTKILRQHTAATDPFGKQFDYPAAFKSLDYNGLKKDLNDLMTDSKDFWPADFGHYGGFFVRMAWHSAGTYRVADGRGGGGEGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGNKISWADLFLLTGNVAIESMGLPTFGFAGGRADTWEADDSVYWGGETTWLGNEVRYSDGKEGLTGDGILDGDQSKKQHTDIHGREMEEPIAAAHMGLIYVNPEGPDGKPDPVASARDIRTTFGRMAMNDAETVALIAGGHAFGKTHGAGPTDNVGKEPNGASIEEQGLGWKNQYKDGKGPNAITSGLEVIWTSTPTKWSNKYLEYMFKYEWELTKSPAGAHQWTAKTDDEIIPDAYDSTKKHKPTMLTSDLALRFDPEYEKISRDYLENPDKLADAFTRAWFKLLHRDMGPRSRWVGPEIPKEVLIWEDPVPSVNHPLVDEKDVAALKKAIIATGVEPTALISAAWASASSYRGSDKRGGANGARVRLEPQKDWKVNNPSQLSKTLSALEGVQKDFNASSGSKKVSLADLIVLAGSAGIEKTSGVHVPFTPGRTDATQEQTDAQSFTHLEPKVDGFRNYGKGTKRVRAEQCLIDKAHLLTLTAPEMTALVGGLRSLNQNFDGSKHGVFTERPGVLSNDFFVNLLDSNIDWKATGDETYEGVERSSGQKKWTATRHDLVFGSHPELRAVSEVYGSSDGADKFTRDFVSAWEKVMNADRFDLKAGQVSSAKL

Retrieve as FASTA  
Remarks complete sequence from genomic (1 intron) and 12 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCAAACGGTTGCCCAATCAAGCTCGCCAACGTCGGCGGTGGTGGTACCCGCAACAGGGACTGGTGAGTGATTGCACATGTCCTTCTCACTCCAATGGCACAGAGCTGACTGTAA
TCCTCTCCCAGGTGGCCAAATGAGCTCAACACCAAGATTCTGCGCCAGCACACCGCTGCTACCGACCCATTCGGCAAGCAGTTTGACTACCCTGCCGCATTCAAGAGCTTGGATTACAAT
GGCCTCAAGAAGGACCTCAACGACCTCATGACCGACTCGAAGGACTTCTGGCCAGCAGATTTCGGCCACTACGGTGGTTTCTTCGTCCGCATGGCATGGCACAGCGCTGGTACATACCGT
GTCGCTGACGGTCGCGGCGGTGGTGGTGAGGGACAGCAGCGATTCGCTCCTCTCAACTCATGGCCCGACAACGCCAATCTCGACAAGGCTCGCCGCCTGTTGTGGCCAATCAAGCAAAAG
TACGGAAACAAGATCTCATGGGCCGACCTGTTCCTCCTCACTGGAAATGTCGCCATTGAGTCTATGGGTCTGCCCACGTTTGGTTTCGCCGGTGGCCGTGCCGACACATGGGAGGCGGAT
GACTCCGTATACTGGGGTGGTGAGACCACCTGGTTGGGCAACGAGGTCCGTTACTCCGACGGCAAGGAGGGTCTTACCGGCGATGGTATCCTTGACGGCGACCAGAGCAAGAAGCAGCAC
ACCGACATCCACGGACGCGAGATGGAGGAGCCAATTGCTGCTGCCCACATGGGTCTGATCTACGTCAACCCAGAGGGTCCAGACGGCAAGCCTGACCCAGTCGCATCTGCCCGCGATATC
CGCACCACATTCGGCCGCATGGCCATGAACGACGCTGAGACCGTTGCTCTGATCGCTGGCGGTCACGCATTCGGTAAGACCCACGGTGCTGGTCCCACCGACAACGTCGGCAAGGAGCCA
AACGGCGCCTCCATCGAGGAGCAGGGTCTCGGATGGAAGAACCAGTACAAGGACGGCAAGGGTCCTAACGCCATCACATCCGGATTGGAAGTCATCTGGACGTCTACCCCAACCAAGTGG
TCGAACAAGTACCTCGAGTACATGTTCAAGTACGAGTGGGAGCTCACCAAGTCTCCCGCTGGCGCACACCAGTGGACGGCGAAGACCGACGACGAGATCATCCCTGATGCCTACGACTCG
ACCAAGAAGCACAAGCCAACCATGTTGACTTCTGACTTGGCTCTCCGCTTCGACCCAGAGTACGAGAAGATCTCCCGCGACTACCTCGAGAACCCAGACAAGCTTGCCGACGCCTTCACC
CGCGCATGGTTCAAGCTTCTCCACCGTGACATGGGCCCTCGCTCTCGCTGGGTCGGACCTGAGATTCCTAAGGAGGTTCTCATCTGGGAGGACCCAGTCCCATCCGTCAACCACCCTCTC
GTTGACGAGAAGGACGTTGCCGCTTTGAAGAAGGCCATCATCGCGACCGGTGTCGAGCCAACTGCGCTCATCTCCGCTGCATGGGCATCCGCCTCGTCTTACCGCGGTAGCGACAAGCGC
GGTGGTGCCAACGGTGCTCGTGTCCGCCTCGAACCCCAGAAGGACTGGAAGGTGAACAACCCATCTCAGCTCTCCAAGACTCTTTCCGCGCTCGAGGGCGTGCAGAAGGACTTCAACGCC
TCCTCCGGCTCCAAGAAGGTCTCTCTCGCCGACTTGATCGTCCTCGCCGGTTCCGCCGGTATCGAGAAGACCTCTGGCGTCCACGTTCCGTTCACTCCTGGCCGCACCGACGCCACCCAG
GAGCAGACCGATGCCCAGTCTTTCACCCACCTCGAGCCAAAGGTCGACGGTTTCCGCAACTACGGCAAGGGCACCAAGCGTGTTCGCGCCGAGCAGTGCCTGATCGACAAGGCCCACCTT
CTTACCCTCACCGCACCCGAGATGACCGCTCTTGTCGGTGGTCTTCGCTCGCTCAACCAGAACTTCGACGGATCCAAGCACGGAGTTTTCACCGAGCGTCCTGGTGTCCTCTCCAACGAC
TTCTTCGTCAACCTCCTCGACAGCAACATCGACTGGAAGGCGACGGGCGACGAGACCTACGAGGGTGTCGAGCGCAGCAGCGGCCAGAAGAAGTGGACCGCCACTCGCCACGATCTGGTC
TTCGGTTCGCACCCTGAGCTGAGGGCTGTGTCTGAGGTGTACGGCTCCAGCGACGGTGCGGACAAGTTCACCCGTGACTTCGTCTCTGCATGGGAGAAGGTTATGAACGCTGACCGATTT
GACCTCAAGGCTGGTCAGGTCAGCAGCGCGAAGTTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCAAACGGTTGCCCAATCAAGCTCGCCAACGTCGGCGGTGGTGGTACCCGCAACAGGGACTGGTGGCCAAATGAGCTCAACACCAAGATTCTGCGCCAGCACACCGCTGCTACC
GACCCATTCGGCAAGCAGTTTGACTACCCTGCCGCATTCAAGAGCTTGGATTACAATGGCCTCAAGAAGGACCTCAACGACCTCATGACCGACTCGAAGGACTTCTGGCCAGCAGATTTC
GGCCACTACGGTGGTTTCTTCGTCCGCATGGCATGGCACAGCGCTGGTACATACCGTGTCGCTGACGGTCGCGGCGGTGGTGGTGAGGGACAGCAGCGATTCGCTCCTCTCAACTCATGG
CCCGACAACGCCAATCTCGACAAGGCTCGCCGCCTGTTGTGGCCAATCAAGCAAAAGTACGGAAACAAGATCTCATGGGCCGACCTGTTCCTCCTCACTGGAAATGTCGCCATTGAGTCT
ATGGGTCTGCCCACGTTTGGTTTCGCCGGTGGCCGTGCCGACACATGGGAGGCGGATGACTCCGTATACTGGGGTGGTGAGACCACCTGGTTGGGCAACGAGGTCCGTTACTCCGACGGC
AAGGAGGGTCTTACCGGCGATGGTATCCTTGACGGCGACCAGAGCAAGAAGCAGCACACCGACATCCACGGACGCGAGATGGAGGAGCCAATTGCTGCTGCCCACATGGGTCTGATCTAC
GTCAACCCAGAGGGTCCAGACGGCAAGCCTGACCCAGTCGCATCTGCCCGCGATATCCGCACCACATTCGGCCGCATGGCCATGAACGACGCTGAGACCGTTGCTCTGATCGCTGGCGGT
CACGCATTCGGTAAGACCCACGGTGCTGGTCCCACCGACAACGTCGGCAAGGAGCCAAACGGCGCCTCCATCGAGGAGCAGGGTCTCGGATGGAAGAACCAGTACAAGGACGGCAAGGGT
CCTAACGCCATCACATCCGGATTGGAAGTCATCTGGACGTCTACCCCAACCAAGTGGTCGAACAAGTACCTCGAGTACATGTTCAAGTACGAGTGGGAGCTCACCAAGTCTCCCGCTGGC
GCACACCAGTGGACGGCGAAGACCGACGACGAGATCATCCCTGATGCCTACGACTCGACCAAGAAGCACAAGCCAACCATGTTGACTTCTGACTTGGCTCTCCGCTTCGACCCAGAGTAC
GAGAAGATCTCCCGCGACTACCTCGAGAACCCAGACAAGCTTGCCGACGCCTTCACCCGCGCATGGTTCAAGCTTCTCCACCGTGACATGGGCCCTCGCTCTCGCTGGGTCGGACCTGAG
ATTCCTAAGGAGGTTCTCATCTGGGAGGACCCAGTCCCATCCGTCAACCACCCTCTCGTTGACGAGAAGGACGTTGCCGCTTTGAAGAAGGCCATCATCGCGACCGGTGTCGAGCCAACT
GCGCTCATCTCCGCTGCATGGGCATCCGCCTCGTCTTACCGCGGTAGCGACAAGCGCGGTGGTGCCAACGGTGCTCGTGTCCGCCTCGAACCCCAGAAGGACTGGAAGGTGAACAACCCA
TCTCAGCTCTCCAAGACTCTTTCCGCGCTCGAGGGCGTGCAGAAGGACTTCAACGCCTCCTCCGGCTCCAAGAAGGTCTCTCTCGCCGACTTGATCGTCCTCGCCGGTTCCGCCGGTATC
GAGAAGACCTCTGGCGTCCACGTTCCGTTCACTCCTGGCCGCACCGACGCCACCCAGGAGCAGACCGATGCCCAGTCTTTCACCCACCTCGAGCCAAAGGTCGACGGTTTCCGCAACTAC
GGCAAGGGCACCAAGCGTGTTCGCGCCGAGCAGTGCCTGATCGACAAGGCCCACCTTCTTACCCTCACCGCACCCGAGATGACCGCTCTTGTCGGTGGTCTTCGCTCGCTCAACCAGAAC
TTCGACGGATCCAAGCACGGAGTTTTCACCGAGCGTCCTGGTGTCCTCTCCAACGACTTCTTCGTCAACCTCCTCGACAGCAACATCGACTGGAAGGCGACGGGCGACGAGACCTACGAG
GGTGTCGAGCGCAGCAGCGGCCAGAAGAAGTGGACCGCCACTCGCCACGATCTGGTCTTCGGTTCGCACCCTGAGCTGAGGGCTGTGTCTGAGGTGTACGGCTCCAGCGACGGTGCGGAC
AAGTTCACCCGTGACTTCGTCTCTGCATGGGAGAAGGTTATGAACGCTGACCGATTTGACCTCAAGGCTGGTCAGGTCAGCAGCGCGAAGTTGTAG

Retrieve as FASTA