Entry information : HjCP01
Entry ID 2539
Creation 2006-11-30 (Filippo Passardi)
Last sequence changes 2011-05-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: HjCP01
Name HjCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Hypocrea jecorina (Trichoderma reesei)    [TaxId: 51453 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HjCP01
start..stop
S start..stop
TatCP01 1342 0 5..757 6..757
TaspCP02 1326 0 5..757 6..758
TviCP01 1318 0 1..759 1..758
TharCP01 1303 0 5..759 6..761
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 164303..164629 327 N° 2 164696..165067 372 N° 3 165143..166723 1581  
join(164303..164629,164696..165067,165143..166723)


exon

Literature and cross-references HjCP01
Literature Diener,S.E., Dunn-Coleman,N., Foreman,P., Houfek,T.D., Teunissen ,P.J.M., van Solingen,P., Dankmeyer,L., Mitchell,T.K., Ward,M. and Dean,R.A. Characterization of the protein processing and secretion pathways in a comprehensive set of expressed sequence tags from Trichoderma reesei. FEMS Microbiol. Lett. 230 (2), 275-282 (2004)
DNA ref. JGI genome:   scaffold_27 (164303..166723)
Protein sequence: HjCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   759
PWM (Da):   %s   82886.02  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEKKCPVNHINAAGHGTRNKDWWPESLKLNILRQHTDVTNPLGPDFDYPAAFKTLDYDAVKKDLTALMTDSQDWWPADFGHYGGLFIRLAWHSAGTYRVTDGRGGGGQGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKLSWADLLILSGNVALESMGFKTLGFAGGRPDTWEADEAAYWGGETTWLGNDVRYAHGFEGTKPGSHGVVDSDEKRHTDIHSRELETPLAAAHMGLIYVNPEGPDASGDPVAAARDIRVTFGRMAMNDEETVALIAGGHTFGKTHGAGPSSHVGPEPAAAPLENQGLGWANSFGSGKGPDTITSGLEVTWTKTPTKWSNQYLEYLFKYDWELTTSPAGAKQYVAKNAEPIIPHAYDPNKKLLPTMLTTDLALRFDPAYEKISRRFLEHPDQFADAFAKAWFKLTHRDMGPLSRYVGPEVPKEEFAWQDPIPPVNFALINESDIAALKKEILNSGVAPSKLISTAWASASTFRGSDKRGGANGARIRLAPQKDWKVNNPPQLAEVLQALEKIQKSFNSSQSGGKKVSLADLIVLAGAAAVEKAAKDAGHDITVPFIPGRNDATQEQTDVESIGHLEPVADGFRNYGKSTPRVKLEHSLVDRAQLLTLTVPELTVLVGGLRVLGTNWDGSSHGVFTNRPGALTNDFFVNLLDMGTAWKANPSDIDLFEGTDRKTGAKKWTGTRVDLIFGAHPELRAVAEVYGSSDGGQKFVKDFVAAWTKVSNLDRFDLPRDSPSRPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns) and 19 ESTs. Strain="QM6a" and "QM9414".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGAAGAAGTGCCCCGTCAACCATATCAACGCCGCAGGCCACGGCACCAGGAACAAGGACTGGTGGCCCGAGTCCCTCAAGCTCAACATCCTCCGCCAGCACACAGACGTCACC
AATCCTCTCGGCCCCGACTTTGACTACCCGGCTGCCTTCAAGACCCTCGACTACGATGCCGTCAAGAAGGACCTTACGGCCCTGATGACCGATTCTCAGGACTGGTGGCCCGCCGACTTT
GGCCACTACGGAGGCCTCTTTATCCGGCTGGCATGGCACAGCGCTGGCACGTATCGTGTCACTGACGGCCGTGGCGGCGGTGGCCAG
GTAAGAATAAACAAATTCGAAGAATTGTGAACA
GAACATCACTAATTCATCCCCCCCCGAAAACAGGGCCAACAACGATTCGCACCTCTCAACAGCTGGCCCGACAACGTGAGCTTGGACAAGGCTCGCCGTCTGCTGTGGCCCATCAAGCAA
AAGTACGGCAACAAGCTCTCGTGGGCCGACCTCCTCATCCTCTCCGGCAACGTGGCTCTCGAGTCCATGGGCTTCAAGACGCTCGGATTTGCCGGCGGCCGTCCAGACACTTGGGAGGCT
GACGAGGCTGCCTACTGGGGCGGCGAGACTACGTGGCTGGGCAACGATGTTCGATATGCCCACGGCTTCGAGGGCACAAAGCCTGGCTCTCACGGTGTCGTTGACTCCGACGAGAAGAGG
CACACTGATATTCACTCTCGCGAGCTCGAGACTCCCTTGGCTGCT
GTATGTATTTTCCCCATTAGTAACCACTTCTCGGCCGCACCGAACATTATATACTGACTCTTATTCTCATGACAG

GCGCACATGGGTCTGATCTATGTCAACCCTGAGGGTCCCGATGCCAGTGGTGACCCTGTTGCCGCTGCTCGCGACATCCGCGTCACCTTTGGCCGCATGGCCATGAATGACGAAGAGACT
GTCGCTCTGATCGCTGGTGGCCACACCTTTGGCAAGACTCACGGTGCCGGTCCCTCGAGCCACGTTGGTCCCGAGCCTGCTGCCGCTCCTCTCGAGAACCAGGGCCTTGGCTGGGCCAAC
AGCTTCGGCTCTGGAAAGGGCCCCGACACCATCACCAGTGGCCTGGAGGTGACCTGGACCAAGACGCCTACCAAGTGGAGCAACCAGTATCTGGAGTATCTCTTCAAGTACGACTGGGAG
CTCACGACCAGCCCTGCCGGAGCCAAGCAGTATGTGGCCAAGAACGCCGAGCCCATCATCCCTCACGCCTATGATCCCAACAAGAAGCTGTTGCCTACCATGCTGACGACGGATCTGGCG
CTGCGCTTTGACCCTGCCTACGAGAAGATTTCTCGTCGCTTCCTGGAGCATCCCGATCAGTTCGCCGATGCGTTTGCAAAGGCCTGGTTCAAGCTGACGCACCGTGACATGGGCCCCCTG
AGCCGATATGTTGGCCCTGAAGTCCCCAAGGAGGAGTTTGCCTGGCAGGACCCCATCCCTCCCGTCAACTTTGCGCTGATCAACGAGAGCGACATTGCTGCGCTCAAGAAGGAGATTCTC
AACTCTGGCGTGGCTCCGTCCAAGCTCATCTCGACCGCTTGGGCATCGGCCTCGACGTTCCGTGGCAGCGACAAGCGAGGCGGAGCCAACGGTGCCCGCATCCGTCTGGCGCCCCAGAAG
GATTGGAAGGTCAACAACCCTCCTCAGCTGGCCGAGGTCCTTCAGGCACTGGAGAAGATTCAGAAGAGCTTCAACAGCTCCCAGAGCGGCGGCAAGAAGGTGTCGCTGGCTGACCTCATT
GTTCTGGCTGGAGCTGCCGCCGTTGAAAAGGCCGCCAAGGATGCCGGACACGACATCACCGTCCCCTTTATCCCTGGCCGCAACGATGCCACCCAGGAGCAGACGGATGTCGAGTCTATT
GGCCACCTCGAGCCCGTCGCCGATGGTTTCCGCAACTACGGCAAGTCGACGCCCAGAGTCAAGCTGGAGCACTCGTTGGTCGACAGGGCCCAGCTCCTCACTCTTACCGTGCCTGAGCTG
ACTGTCCTCGTTGGCGGTCTGCGTGTGCTCGGCACGAACTGGGACGGATCATCTCACGGTGTCTTCACCAACCGTCCCGGAGCGCTGACCAACGACTTCTTCGTCAACCTCTTGGATATG
GGCACCGCCTGGAAGGCCAACCCGTCTGATATCGATCTCTTTGAGGGTACCGACCGCAAGACTGGTGCAAAGAAGTGGACGGGCACTCGCGTCGATCTCATCTTTGGCGCTCACCCCGAG
CTCCGCGCCGTTGCCGAAGTCTACGGCAGCTCCGACGGTGGCCAGAAGTTTGTCAAGGACTTTGTGGCTGCTTGGACCAAGGTGTCGAACCTGGATCGCTTCGACCTGCCCAGAGATTCT
CCCTCCAGGCCTCGCTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGAAGAAGTGCCCCGTCAACCATATCAACGCCGCAGGCCACGGCACCAGGAACAAGGACTGGTGGCCCGAGTCCCTCAAGCTCAACATCCTCCGCCAGCACACAGACGTCACC
AATCCTCTCGGCCCCGACTTTGACTACCCGGCTGCCTTCAAGACCCTCGACTACGATGCCGTCAAGAAGGACCTTACGGCCCTGATGACCGATTCTCAGGACTGGTGGCCCGCCGACTTT
GGCCACTACGGAGGCCTCTTTATCCGGCTGGCATGGCACAGCGCTGGCACGTATCGTGTCACTGACGGCCGTGGCGGCGGTGGCCAG
GGCCAACAACGATTCGCACCTCTCAACAGCTGG
CCCGACAACGTGAGCTTGGACAAGGCTCGCCGTCTGCTGTGGCCCATCAAGCAAAAGTACGGCAACAAGCTCTCGTGGGCCGACCTCCTCATCCTCTCCGGCAACGTGGCTCTCGAGTCC
ATGGGCTTCAAGACGCTCGGATTTGCCGGCGGCCGTCCAGACACTTGGGAGGCTGACGAGGCTGCCTACTGGGGCGGCGAGACTACGTGGCTGGGCAACGATGTTCGATATGCCCACGGC
TTCGAGGGCACAAAGCCTGGCTCTCACGGTGTCGTTGACTCCGACGAGAAGAGGCACACTGATATTCACTCTCGCGAGCTCGAGACTCCCTTGGCTGCT
GCGCACATGGGTCTGATCTAT
GTCAACCCTGAGGGTCCCGATGCCAGTGGTGACCCTGTTGCCGCTGCTCGCGACATCCGCGTCACCTTTGGCCGCATGGCCATGAATGACGAAGAGACTGTCGCTCTGATCGCTGGTGGC
CACACCTTTGGCAAGACTCACGGTGCCGGTCCCTCGAGCCACGTTGGTCCCGAGCCTGCTGCCGCTCCTCTCGAGAACCAGGGCCTTGGCTGGGCCAACAGCTTCGGCTCTGGAAAGGGC
CCCGACACCATCACCAGTGGCCTGGAGGTGACCTGGACCAAGACGCCTACCAAGTGGAGCAACCAGTATCTGGAGTATCTCTTCAAGTACGACTGGGAGCTCACGACCAGCCCTGCCGGA
GCCAAGCAGTATGTGGCCAAGAACGCCGAGCCCATCATCCCTCACGCCTATGATCCCAACAAGAAGCTGTTGCCTACCATGCTGACGACGGATCTGGCGCTGCGCTTTGACCCTGCCTAC
GAGAAGATTTCTCGTCGCTTCCTGGAGCATCCCGATCAGTTCGCCGATGCGTTTGCAAAGGCCTGGTTCAAGCTGACGCACCGTGACATGGGCCCCCTGAGCCGATATGTTGGCCCTGAA
GTCCCCAAGGAGGAGTTTGCCTGGCAGGACCCCATCCCTCCCGTCAACTTTGCGCTGATCAACGAGAGCGACATTGCTGCGCTCAAGAAGGAGATTCTCAACTCTGGCGTGGCTCCGTCC
AAGCTCATCTCGACCGCTTGGGCATCGGCCTCGACGTTCCGTGGCAGCGACAAGCGAGGCGGAGCCAACGGTGCCCGCATCCGTCTGGCGCCCCAGAAGGATTGGAAGGTCAACAACCCT
CCTCAGCTGGCCGAGGTCCTTCAGGCACTGGAGAAGATTCAGAAGAGCTTCAACAGCTCCCAGAGCGGCGGCAAGAAGGTGTCGCTGGCTGACCTCATTGTTCTGGCTGGAGCTGCCGCC
GTTGAAAAGGCCGCCAAGGATGCCGGACACGACATCACCGTCCCCTTTATCCCTGGCCGCAACGATGCCACCCAGGAGCAGACGGATGTCGAGTCTATTGGCCACCTCGAGCCCGTCGCC
GATGGTTTCCGCAACTACGGCAAGTCGACGCCCAGAGTCAAGCTGGAGCACTCGTTGGTCGACAGGGCCCAGCTCCTCACTCTTACCGTGCCTGAGCTGACTGTCCTCGTTGGCGGTCTG
CGTGTGCTCGGCACGAACTGGGACGGATCATCTCACGGTGTCTTCACCAACCGTCCCGGAGCGCTGACCAACGACTTCTTCGTCAACCTCTTGGATATGGGCACCGCCTGGAAGGCCAAC
CCGTCTGATATCGATCTCTTTGAGGGTACCGACCGCAAGACTGGTGCAAAGAAGTGGACGGGCACTCGCGTCGATCTCATCTTTGGCGCTCACCCCGAGCTCCGCGCCGTTGCCGAAGTC
TACGGCAGCTCCGACGGTGGCCAGAAGTTTGTCAAGGACTTTGTGGCTGCTTGGACCAAGGTGTCGAACCTGGATCGCTTCGACCTGCCCAGAGATTCTCCCTCCAGGCCTCGCTTGTAA

Retrieve as FASTA