Entry information : PtrCP01
Entry ID 2541
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2011-05-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-12 (Christophe Dunand)
Peroxidase information: PtrCP01
Name PtrCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Bacillariophyta Bacillariophyceae Phaeodactylaceae Phaeodactylum
Organism Phaeodactylum tricornutum    [TaxId: 2850 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtrCP01
start..stop
S start..stop
SpliCP01 920 0 4..735 21..748
TcurCP01 919 0 20..735 39..744
PstaCP01 917 0 1..735 74..806
DhaCP01_DCB2 905 0 4..735 3..729
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 598593..598856 264 N° 2 598941..600887 1947  
join(598593..598856,598941..600887)


exon

Literature and cross-references PtrCP01
Literature Scala,S., Carels,N., Falciatore,A., Chiusano,M.L. and Bowler,C. Genome properties of the diatom Phaeodactylum tricornutum. Plant Physiol. 129 (3), 993-1002 (2002)
DNA ref. JGI genome:   chr_3 (598593..600887)
EST ref. GenBank:   CT949448 [5' end]   CT872107 [3' end]   CT873315 [Fragment]   CT891766 [Fragment]
Cluster/Prediction ref. UniGene:   Ptc.2227
Protein sequence: PtrCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   736
PWM (Da):   %s   82287.34  
PI (pH):   %s   5.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSDSKCPFAPKMNKAASANSYWWPDNINLKILNQQGANNPDPSFNYKEAFRELDVEMVKRDVNKMLTTSQDWWPADWGHYGPFMIRMAWHAAGTYRISDGRGGANTANQRFAPLNSWPDNANLDKARRLMWPVKQKYGRKLSWGDLMMLTGNQALEIMGLKTIGFAFGREDIYSPEDDVYWGPEKEMLSNDRFDENGDIKRPLGASEMGLIYVNPEGHDNEPNPTKSAHDIRQTFRNMAMDDYETVALIAGGHTFGKTHGAAPVSHQGPEPEGASIEHQQLGYLSDYGTGKGKDTTTSGLEGAWTETPIQWDMNYFKNLFEYEWEVHKGPGGRHQWRPTDKSTFEMVPDAHEKGKKNPPMMFTTDISLKIDPIYGPISRHFYHHPDEFSAAFAKAWYKLLHRDMGPVSRCLGSDVPEPQLWQDPIPSLDHELIDDEDVAKLKKQILGSTGIAGKILGSSGPCVSELVKVAWGSACTYRGTDHRGGANGARIRLAPQNTWKVNDPEELKRVLEHLEQIQLDFNEQQKGSNKRVSLADLIVLGGCAAIEYAAKNAGNDINIPFSPGRTDASSEQTVAESFDALEPSADGFRNYLKEGQSAKPEELLLNHAHLLTLTSPEMTVLLGGLRVLKANTGNSEMGVFTKNPETLTNDFFVNLLDINTTWSSVEQDKNLFDGLEYGTGKLNWKASRFDLIFGSNSELRAIAEYYGSDDSNEVFLKDFVKAWTKVMELDRFDLK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 1 introns) and 30 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCCGATAGCAAATGCCCCTTTGCACCCAAAATGAACAAAGCTGCTTCGGCGAACAGCTATTGGTGGCCTGATAATATCAACCTGAAAATACTAAATCAGCAAGGGGCCAACAAC
CCCGACCCTTCCTTTAATTACAAGGAAGCGTTCCGAGAGTTGGACGTTGAGATGGTGAAGCGTGATGTCAACAAGATGCTGACTACCTCTCAGGACTGGTGGCCTGCTGATTGGGGTCAC
TATGGGCCTTTTATGATTCGAATG
GTACGTACACCAACGCCTTGTAGACTTCGTCGCGGTTTCGATTGCTGTGCACCTAACGCGTATACTTTCTTGTTTCGCGCACAGGCATGGCACGCG
GCAGGAACCTACCGTATTTCCGATGGAAGAGGCGGTGCCAACACCGCTAACCAACGTTTCGCGCCATTGAATAGCTGGCCGGACAACGCCAACCTTGATAAGGCTCGTCGTCTCATGTGG
CCAGTTAAGCAAAAGTATGGCCGAAAGCTTTCGTGGGGTGATTTAATGATGCTCACGGGTAATCAGGCTTTGGAAATTATGGGCCTAAAAACAATTGGCTTTGCATTTGGTCGTGAAGAT
ATATACTCCCCCGAGGACGATGTGTACTGGGGTCCGGAAAAGGAGATGCTCAGTAACGATAGGTTCGACGAGAACGGTGATATTAAACGCCCACTTGGAGCCTCCGAAATGGGTCTCATT
TACGTAAATCCTGAAGGTCATGATAACGAGCCGAATCCAACGAAGTCTGCTCACGATATCCGTCAGACCTTCAGAAATATGGCCATGGACGATTACGAAACTGTCGCACTTATTGCTGGT
GGACATACATTTGGAAAGACCCATGGCGCCGCTCCAGTATCACACCAAGGACCAGAACCGGAAGGTGCATCAATCGAACATCAACAGCTTGGCTATCTGAGCGACTACGGGACCGGTAAA
GGAAAAGATACCACCACTAGTGGTCTCGAAGGAGCTTGGACCGAAACCCCAATCCAATGGGATATGAACTATTTCAAGAATTTGTTCGAGTATGAATGGGAGGTTCATAAAGGCCCGGGG
GGTCGCCACCAATGGAGACCGACCGACAAGTCTACCTTTGAAATGGTACCCGATGCTCACGAGAAGGGTAAAAAGAACCCCCCAATGATGTTCACCACTGACATTTCGTTGAAGATCGAT
CCAATCTACGGGCCGATCTCTCGTCACTTCTACCATCATCCAGATGAATTTTCTGCTGCTTTTGCAAAGGCATGGTACAAGTTATTACACCGTGATATGGGACCAGTCTCTCGTTGTCTA
GGAAGCGATGTTCCGGAACCCCAATTGTGGCAGGATCCGATCCCCTCTCTTGACCATGAGCTGATCGACGACGAAGATGTTGCCAAACTTAAAAAGCAAATTCTTGGCTCGACCGGTATC
GCCGGCAAGATTTTGGGGTCTAGCGGCCCTTGTGTATCTGAACTAGTGAAGGTTGCCTGGGGTTCTGCATGTACATACCGAGGCACGGATCACCGTGGCGGAGCGAATGGTGCTCGTATC
CGTTTGGCACCCCAAAACACTTGGAAGGTAAATGACCCGGAAGAGCTCAAAAGAGTGCTAGAACATCTGGAACAGATTCAACTAGACTTCAATGAGCAACAGAAAGGCAGTAACAAGCGA
GTATCACTAGCAGATTTGATTGTTCTAGGTGGTTGCGCTGCAATTGAGTATGCTGCCAAAAATGCTGGCAATGATATCAATATACCGTTCTCCCCTGGACGCACGGACGCGTCATCGGAG
CAGACGGTTGCAGAATCATTTGACGCTCTGGAACCGAGCGCAGATGGCTTTCGCAACTATTTGAAAGAAGGCCAAAGTGCCAAACCGGAAGAGCTCCTGTTAAATCATGCTCACTTGCTT
ACTTTGACTTCCCCCGAGATGACGGTGCTATTGGGAGGGCTTCGCGTTTTGAAGGCAAACACGGGAAATTCTGAGATGGGTGTATTTACAAAAAACCCAGAAACGCTAACGAATGATTTC
TTTGTCAATCTTCTGGACATAAACACGACCTGGTCGTCTGTGGAACAAGACAAGAACCTATTCGATGGTCTGGAATACGGCACAGGGAAACTGAATTGGAAAGCGAGTCGTTTCGATTTG
ATCTTTGGTTCCAATTCTGAGCTCCGTGCGATTGCAGAGTATTACGGTAGTGATGATTCAAACGAAGTGTTTTTAAAGGATTTTGTCAAAGCTTGGACAAAGGTGATGGAGCTTGATCGT
TTTGATTTGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCCGATAGCAAATGCCCCTTTGCACCCAAAATGAACAAAGCTGCTTCGGCGAACAGCTATTGGTGGCCTGATAATATCAACCTGAAAATACTAAATCAGCAAGGGGCCAACAAC
CCCGACCCTTCCTTTAATTACAAGGAAGCGTTCCGAGAGTTGGACGTTGAGATGGTGAAGCGTGATGTCAACAAGATGCTGACTACCTCTCAGGACTGGTGGCCTGCTGATTGGGGTCAC
TATGGGCCTTTTATGATTCGAATG
GCATGGCACGCGGCAGGAACCTACCGTATTTCCGATGGAAGAGGCGGTGCCAACACCGCTAACCAACGTTTCGCGCCATTGAATAGCTGGCCGGAC
AACGCCAACCTTGATAAGGCTCGTCGTCTCATGTGGCCAGTTAAGCAAAAGTATGGCCGAAAGCTTTCGTGGGGTGATTTAATGATGCTCACGGGTAATCAGGCTTTGGAAATTATGGGC
CTAAAAACAATTGGCTTTGCATTTGGTCGTGAAGATATATACTCCCCCGAGGACGATGTGTACTGGGGTCCGGAAAAGGAGATGCTCAGTAACGATAGGTTCGACGAGAACGGTGATATT
AAACGCCCACTTGGAGCCTCCGAAATGGGTCTCATTTACGTAAATCCTGAAGGTCATGATAACGAGCCGAATCCAACGAAGTCTGCTCACGATATCCGTCAGACCTTCAGAAATATGGCC
ATGGACGATTACGAAACTGTCGCACTTATTGCTGGTGGACATACATTTGGAAAGACCCATGGCGCCGCTCCAGTATCACACCAAGGACCAGAACCGGAAGGTGCATCAATCGAACATCAA
CAGCTTGGCTATCTGAGCGACTACGGGACCGGTAAAGGAAAAGATACCACCACTAGTGGTCTCGAAGGAGCTTGGACCGAAACCCCAATCCAATGGGATATGAACTATTTCAAGAATTTG
TTCGAGTATGAATGGGAGGTTCATAAAGGCCCGGGGGGTCGCCACCAATGGAGACCGACCGACAAGTCTACCTTTGAAATGGTACCCGATGCTCACGAGAAGGGTAAAAAGAACCCCCCA
ATGATGTTCACCACTGACATTTCGTTGAAGATCGATCCAATCTACGGGCCGATCTCTCGTCACTTCTACCATCATCCAGATGAATTTTCTGCTGCTTTTGCAAAGGCATGGTACAAGTTA
TTACACCGTGATATGGGACCAGTCTCTCGTTGTCTAGGAAGCGATGTTCCGGAACCCCAATTGTGGCAGGATCCGATCCCCTCTCTTGACCATGAGCTGATCGACGACGAAGATGTTGCC
AAACTTAAAAAGCAAATTCTTGGCTCGACCGGTATCGCCGGCAAGATTTTGGGGTCTAGCGGCCCTTGTGTATCTGAACTAGTGAAGGTTGCCTGGGGTTCTGCATGTACATACCGAGGC
ACGGATCACCGTGGCGGAGCGAATGGTGCTCGTATCCGTTTGGCACCCCAAAACACTTGGAAGGTAAATGACCCGGAAGAGCTCAAAAGAGTGCTAGAACATCTGGAACAGATTCAACTA
GACTTCAATGAGCAACAGAAAGGCAGTAACAAGCGAGTATCACTAGCAGATTTGATTGTTCTAGGTGGTTGCGCTGCAATTGAGTATGCTGCCAAAAATGCTGGCAATGATATCAATATA
CCGTTCTCCCCTGGACGCACGGACGCGTCATCGGAGCAGACGGTTGCAGAATCATTTGACGCTCTGGAACCGAGCGCAGATGGCTTTCGCAACTATTTGAAAGAAGGCCAAAGTGCCAAA
CCGGAAGAGCTCCTGTTAAATCATGCTCACTTGCTTACTTTGACTTCCCCCGAGATGACGGTGCTATTGGGAGGGCTTCGCGTTTTGAAGGCAAACACGGGAAATTCTGAGATGGGTGTA
TTTACAAAAAACCCAGAAACGCTAACGAATGATTTCTTTGTCAATCTTCTGGACATAAACACGACCTGGTCGTCTGTGGAACAAGACAAGAACCTATTCGATGGTCTGGAATACGGCACA
GGGAAACTGAATTGGAAAGCGAGTCGTTTCGATTTGATCTTTGGTTCCAATTCTGAGCTCCGTGCGATTGCAGAGTATTACGGTAGTGATGATTCAAACGAAGTGTTTTTAAAGGATTTT
GTCAAAGCTTGGACAAAGGTGATGGAGCTTGATCGTTTTGATTTGAAATAA

Retrieve as FASTA