Entry information : TpsCP01
Entry ID 2544
Creation 2005-11-16 (Christophe Dunand)
Last sequence changes 2011-05-20 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-20 (Christophe Dunand)
Peroxidase information: TpsCP01
Name TpsCP01
Class Catalase peroxidase     [Orthogroup: CP001]*
Taxonomy Eukaryota Bacillariophyta Coscinodiscophyceae Thalassiosiraceae Thalassiosira
Organism Thalassiosira pseudonana    [TaxId: 35128 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TpsCP01
start..stop
S start..stop
SpliCP01 853 0 4..724 21..748
MAspCP01 845 0 1..724 6..736
FspCP_CcI3 825 0 7..725 20..744
TcurCP01 823 0 23..724 40..744
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..127 127 N° 2 209..356 148 N° 3 451..619 169 N° 4 689..883 195
N° 5 982..2550 1569  
join(1..127,209..356,451..619,689..883,982..2550)


exon

Literature and cross-references TpsCP01
Literature Armbrust,E.V., et al., The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and metabolism. Science 306 (5693), 79-86 (2004).
DNA ref. GenBank:   NC_012083.1 (669124..671673)
Protein sequence: TpsCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   735
PWM (Da):   %s   81476.53  
PI (pH):   %s   6.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAESKCPYKGGSTPTTKPQTIRDWWPDSLDLRILHQDPITAHSFAQLDLHQLRNDIYKALTTSNPNWPADYGHYGPLMIRLAWHSAGTYRVFDGRGGGNSGNIRLAPLNSWPDNANLDKARRYILWPIKQKYGQQISWSDLIVLAGWEDTTPLWFGGGRIDAFAPEEDVFWGNESEWLKDERHEKRSAEDDSTGLEKPLGAVQMGLIYVNPEGPGGNPDILASAKDIRETFSRMGMSDFETVALIAGGHTFGKAHGSADPSKYVGAEPEGAPVEQMGLGWKNAYGTGKGRDTITSGLEGAWTNKPTQWDNGYFELLFKYDWTQSKSPGGATQWIPRRGSGVADVPDAHDASVKHLPIMFTTDLALRYDPIYGPISQRFHLNPHEFTDAFKRAWYKLCHRDMGPLQRHLGQWLPTEDLIWLDPIPSSNGNTINVNDVSILKSKISDLINSSTLSVSDLVKAAWASASTYRCTDHRGGANGGRIRLNPQKSWDVNDPSSLGKVIVTLESIQQNFNAMNSNQVSFADLVVLGGNVAIEEAARRAGHYNVRVTFVPGRMDAFQSQTDVVSFNALQPMVDGFRNYEGNSSTSALRPEEALIDRAHLLTLSAPETVVLLGGMRVLNANTDNSNIGVLTERPGALTNDFFVHLLDENTNWTSMNDGKLFRGRTSRDKNWIASRVDLLLGSNSQLRAIAESYACTDSTKFFVKDFLSVWSKVMMLDRFDMIPPVVEMNSRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 20, 3 introns). no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCGAGAGCAAATGCCCCTACAAAGGCGGCAGCACCCCCACCACCAAACCCCAAACAATCCGAGACTGGTGGCCAGACTCCCTAGATCTGCGAATCCTCCATCAAGATCCAATC
ACCGCCC
GTCCGTCACACGTGCCTCATCCTTTGTCGGCATCTCCCGTCGCCCATCACTTCGTGTCAACATCGTATGCATCCTATGCAGACAGCTTTGCACAGTTGGATCTACACCAGTTG
AGGAACGATATCTACAAGGCGTTGACTACGTCTAATCCCAATTGGCCTGCGGATTATGGTCATTATGGACCGTTGATGATTCGGTTGGCTTGGCATTCTGCCGGGACGTATCGAGT
GTGA
GTACTCAGATTGTCCAGTTTGAAATTGATGTACACCCTGTCCAACGCACATCACTCATTCAACACTTTCTTCCCTTCACTCATCTCGCAGCTTTGACGGACGAGGAGGCGGAAACAGCGG
TAACATCCGTCTTGCACCTCTCAACTCGTGGCCTGACAATGCCAACCTCGACAAAGCCCGTCGATACATCCTATGGCCGATCAAACAAAAGTACGGACAACAAATCAGTTGGTCTGACTT
GATCGTCCTGGCCGGAAAT
GTAGCTTTGGAAAGCATGGGTCTCGATGGTAGTAGTGGCAATAACAATTATGGGGGAAGTCGAAAAAAGTGGGAGGACACAACGCCATTGTGGTTTGGTGG
TGGAAGGATTGACGCCTTTGCTCCTGAGGAGGATGTGTTTTGGGGGAATGAAAGTGAGTGGTTGAAGGATGAGAGGCATGAGAAGAGGAGTGCGGAAGATGATAGTACGGGGTTGGAGAA
GCCTTTGGGGGCTGTGCAGATGGGGCTGATATATGTCAATCCG
GTGAGTTCTATTTTGACATTATTCTTTAGTGTTGGGTACCATCATTCTCTTGTCCCACCGTACTCATCTTGAGGCAC
CATTCATACTCTCTATCCAAGGAGGGACCTGGAGGTAATCCAGATATACTAGCCTCGGCCAAAGATATTCGTGAAACCTTCTCTCGAATGGGCATGTCCGATTTCGAAACAGTAGCTCTC
ATCGCAGGTGGACATACCTTTGGAAAAGCTCACGGAAGTGCCGATCCTTCCAAGTACGTCGGTGCCGAGCCAGAGGGTGCTCCGGTAGAACAAATGGGATTGGGGTGGAAGAACGCCTAC
GGAACTGGAAAGGGAAGGGATACGATAACTAGTGGGCTTGAGGGAGCATGGACGAACAAACCAACTCAATGGGACAATGGATACTTTGAACTCTTATTCAAGTATGATTGGACTCAGTCG
AAGAGTCCTGGAGGTGCAACTCAATGGATTCCGAGAAGAGGGAGTGGAGTGGCCGATGTTCCAGATGCTCATGATGCATCAGTCAAGCATCTACCAATCATGTTTACTACCGATTTGGCA
CTGCGTTATGATCCGATCTACGGTCCCATATCTCAGAGATTCCACCTTAATCCACACGAGTTTACAGATGCCTTCAAACGTGCTTGGTATAAGTTATGCCATCGTGATATGGGACCGTTG
CAAAGGCATCTTGGGCAGTGGTTGCCGACGGAGGACTTGATTTGGTTGGATCCCATTCCGTCTTCAAACGGCAATACAATCAATGTGAATGATGTTAGTATTTTGAAGAGTAAGATATCA
GATCTCATCAACTCGTCGACGCTGTCAGTATCCGACTTGGTGAAGGCGGCATGGGCATCTGCATCCACCTATCGCTGCACCGATCATCGTGGAGGTGCAAATGGTGGCAGGATTCGTCTC
AATCCGCAGAAAAGTTGGGATGTTAACGATCCGTCCAGCCTTGGTAAGGTCATTGTCACTTTGGAGAGCATTCAGCAGAATTTCAATGCAATGAATAGCAATCAAGTATCATTTGCTGAT
CTGGTAGTGTTGGGAGGTAATGTTGCCATCGAAGAGGCTGCACGTCGAGCCGGTCACTACAATGTTCGTGTAACGTTTGTTCCAGGAAGGATGGATGCATTCCAATCTCAAACGGACGTC
GTGTCATTCAATGCATTGCAGCCGATGGTAGATGGCTTTCGTAACTACGAAGGAAACAGTAGTACTAGTGCATTACGTCCGGAGGAAGCATTGATCGATCGAGCTCATCTCTTGACACTA
TCGGCTCCGGAAACGGTGGTTTTACTCGGCGGTATGCGAGTGTTGAATGCCAATACGGACAATTCAAACATTGGAGTGTTGACGGAACGGCCTGGAGCTTTGACGAATGACTTTTTTGTT
CACTTGCTTGATGAAAACACAAATTGGACTTCCATGAACGATGGAAAGTTGTTCCGAGGAAGGACTTCACGGGACAAGAACTGGATCGCGAGTAGAGTTGATTTGCTATTGGGTTCCAAC
TCCCAACTTCGTGCCATTGCAGAGTCATATGCATGTACTGACTCGACGAAGTTTTTTGTGAAGGACTTTCTAAGTGTATGGAGTAAGGTGATGATGCTGGATAGATTTGATATGATTCCG
CCGGTGGTTGAGATGAATAGTAGATTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCGAGAGCAAATGCCCCTACAAAGGCGGCAGCACCCCCACCACCAAACCCCAAACAATCCGAGACTGGTGGCCAGACTCCCTAGATCTGCGAATCCTCCATCAAGATCCAATC
ACCGCCC
ACAGCTTTGCACAGTTGGATCTACACCAGTTGAGGAACGATATCTACAAGGCGTTGACTACGTCTAATCCCAATTGGCCTGCGGATTATGGTCATTATGGACCGTTGATGATT
CGGTTGGCTTGGCATTCTGCCGGGACGTATCGAGT
CTTTGACGGACGAGGAGGCGGAAACAGCGGTAACATCCGTCTTGCACCTCTCAACTCGTGGCCTGACAATGCCAACCTCGACAAA
GCCCGTCGATACATCCTATGGCCGATCAAACAAAAGTACGGACAACAAATCAGTTGGTCTGACTTGATCGTCCTGGCCGGAAAT
TGGGAGGACACAACGCCATTGTGGTTTGGTGGTGGA
AGGATTGACGCCTTTGCTCCTGAGGAGGATGTGTTTTGGGGGAATGAAAGTGAGTGGTTGAAGGATGAGAGGCATGAGAAGAGGAGTGCGGAAGATGATAGTACGGGGTTGGAGAAGCCT
TTGGGGGCTGTGCAGATGGGGCTGATATATGTCAATCCG
GAGGGACCTGGAGGTAATCCAGATATACTAGCCTCGGCCAAAGATATTCGTGAAACCTTCTCTCGAATGGGCATGTCCGAT
TTCGAAACAGTAGCTCTCATCGCAGGTGGACATACCTTTGGAAAAGCTCACGGAAGTGCCGATCCTTCCAAGTACGTCGGTGCCGAGCCAGAGGGTGCTCCGGTAGAACAAATGGGATTG
GGGTGGAAGAACGCCTACGGAACTGGAAAGGGAAGGGATACGATAACTAGTGGGCTTGAGGGAGCATGGACGAACAAACCAACTCAATGGGACAATGGATACTTTGAACTCTTATTCAAG
TATGATTGGACTCAGTCGAAGAGTCCTGGAGGTGCAACTCAATGGATTCCGAGAAGAGGGAGTGGAGTGGCCGATGTTCCAGATGCTCATGATGCATCAGTCAAGCATCTACCAATCATG
TTTACTACCGATTTGGCACTGCGTTATGATCCGATCTACGGTCCCATATCTCAGAGATTCCACCTTAATCCACACGAGTTTACAGATGCCTTCAAACGTGCTTGGTATAAGTTATGCCAT
CGTGATATGGGACCGTTGCAAAGGCATCTTGGGCAGTGGTTGCCGACGGAGGACTTGATTTGGTTGGATCCCATTCCGTCTTCAAACGGCAATACAATCAATGTGAATGATGTTAGTATT
TTGAAGAGTAAGATATCAGATCTCATCAACTCGTCGACGCTGTCAGTATCCGACTTGGTGAAGGCGGCATGGGCATCTGCATCCACCTATCGCTGCACCGATCATCGTGGAGGTGCAAAT
GGTGGCAGGATTCGTCTCAATCCGCAGAAAAGTTGGGATGTTAACGATCCGTCCAGCCTTGGTAAGGTCATTGTCACTTTGGAGAGCATTCAGCAGAATTTCAATGCAATGAATAGCAAT
CAAGTATCATTTGCTGATCTGGTAGTGTTGGGAGGTAATGTTGCCATCGAAGAGGCTGCACGTCGAGCCGGTCACTACAATGTTCGTGTAACGTTTGTTCCAGGAAGGATGGATGCATTC
CAATCTCAAACGGACGTCGTGTCATTCAATGCATTGCAGCCGATGGTAGATGGCTTTCGTAACTACGAAGGAAACAGTAGTACTAGTGCATTACGTCCGGAGGAAGCATTGATCGATCGA
GCTCATCTCTTGACACTATCGGCTCCGGAAACGGTGGTTTTACTCGGCGGTATGCGAGTGTTGAATGCCAATACGGACAATTCAAACATTGGAGTGTTGACGGAACGGCCTGGAGCTTTG
ACGAATGACTTTTTTGTTCACTTGCTTGATGAAAACACAAATTGGACTTCCATGAACGATGGAAAGTTGTTCCGAGGAAGGACTTCACGGGACAAGAACTGGATCGCGAGTAGAGTTGAT
TTGCTATTGGGTTCCAACTCCCAACTTCGTGCCATTGCAGAGTCATATGCATGTACTGACTCGACGAAGTTTTTTGTGAAGGACTTTCTAAGTGTATGGAGTAAGGTGATGATGCTGGAT
AGATTTGATATGATTCCGCCGGTGGTTGAGATGAATAGTAGATTGTGA

Retrieve as FASTA