Entry information : HaAPx01 (HanXRQChr05g0133141)
Entry ID 2599
Creation 2010-05-26 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPx01 (HanXRQChr05g0133141)
Name (synonym) HaAPx01 (HanXRQChr05g0133141)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation Cytosolic
Tissue type Embryos
Inducer Constitutively induced
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPx01
start..stop
S start..stop
HaAPx02 498 0 1..250 1..250
HpAPx01 497 0 1..250 1..250
HarAPx01 496 0 1..250 1..250
GhyAPx01 477 9e-174 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21038441..21038559 119 N° 2 21039358..21039532 175 N° 3 21039611..21039676 66 N° 4 21039799..21039847 49
N° 5 21039976..21040061 86 N° 6 21040143..21040222 80 N° 7 21040293..21040395 103 N° 8 21040472..21040530 59
N° 9 21040628..21040643 16  
join(21038441..21038559,21039358..21039532,21039611..21039676,21039799..21039847 ,21039976..21040061,21040143..21040222,21040293..21040395,21040472..21040530,210 40628..21040643)


exon

Literature and cross-references HaAPx01 (HanXRQChr05g0133141)
Literature Michelmore,R.W., Knapp,S., Rieseberg,L., Bradford,K., Kesseli,R., Boore,J., Kozik,A., Matvienko,M., Lavelle,D. and Lai,Z. Sunflower (Helianthus annuus) ESTs (set 2) from the Compositae Genome Project http://compgenomics.ucdavis.edu/.
DNA ref. HanXRQ genome:   HanXRQChr05 (21038441..21040643)
EST ref. GenBank:   CD854104
Cluster/Prediction ref. HanXRQ:   HanXRQChr05g0133141 UniGene:   Han.5838
Protein sequence: HaAPx01 (HanXRQChr05g0133141)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   27487.92  
PI (pH):   %s   5.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPCVSEEYKKAVDKARRKLRGFIADKRCAPLMLRLAWHSAGTYDVNTKSGGPFGTMRYKAELSHGANNGLDIAVRLLEPIKEQFPILSYGDFYQLAGVVAVEIAGGPEVPFHPGREDKEEPPVEGRLPDATKGNDHLRDVFVKTMGLDDIDIVTLSGGHTLGAAHKERSGFEGPWTSNPLVFDNSYFTELLAGEKEGLLKLPTDKALLEDPVFRPLVEKYAADEDAFFADYAVSHMKLSELGFAEA*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 16 ESTs. Assembly by PeroxiBase Team. Strain="ANN1312".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTATCCATGTGTTAGTGAGGAGTACAAGAAGGCTGTTGACAAAGCCAGGAGGAAGCTCAGAGGATTTATTGCTGACAAGAGATGTGCTCCTTTGATGCTCCGTCTTGCG
TAAGATTCTGTTATCCCTTTGTATAGGCTAAGACCATGCGTAGTGGTAGAAGGTTATAATGCCCCCACCATGGGGCATTATACGACACGTGGCGTCCTAGTCAGCAAGGGGGCATTATAG
CAAAAGTGGTGTAGTGGGTATAATGCCCCATAATGCCCCTTACAATTATTAAAAAAAAAAAACCTTTTTTAAAAAGCTGAACTATCCCACTCATGTCTCTTCCCATTGGTCAACACTCAC
ATGGTCTCATGCAACTTAGTTTGATTTGGGCGTTTTAAAGAAAACGCCGGAAGAAACATTTTTCAAAAATTTTACAAAATAACGCCCCCTGTAATGGAGGGGTGGGCGTTTTCGGGCGTT
ATTTTTGAAATTTTTTTAAAAAAAACGCCCCACTACACATGGTCAAGGGCTTTTTGTGTTGGTAATTTGCTGATTTAATCGAATGCTAGAGATATTTTATAAAGATAACTTGATTAGTTT
TGTGAGGAAGTTAAGAGACTTAGCATAGCATTAGCATGTATATGATGACTTATGAAAACCTTGTTGTGAGTAATCAGTTTAGTATTGCAACTTTGCAATGATACAAATTGGGTTAATCAA
GAAACATTTTATTTGCCTTTAGGATTTAAAATTAAGCAATAATCATGACCCTGTAATTTGTAGTTCGGATAATATTTTCATGTAATTAGTTTGTAAAACAAATGTTTTTTAACTTGAAAA
GAGCTGTTAGGTAACAGATACACAAACTTCTGTTATCATGTCTTAAAAGGTTTTTCTTTTTCTATAATGGGTTACAGATGGCACTCTGCTGGTACTTATGATGTGAACACCAAAAGCGGA
GGTCCTTTCGGTACCATGAGGTACAAGGCTGAGTTGAGCCATGGTGCCAACAATGGTCTTGACATTGCTGTCAGGCTATTAGAGCCTATCAAGGAACAATTTCCCATCCTTTCATATGGT
GATTTCTATCAG
GTAAGCTAGCTTTGGCTAACTACTTTTGATCTGGATTAACATTTCCATGCTGATTAGCTTCTTAACCTTTTGCTTTAGTTGGCCGGTGTTGTTGCTGTCGAAATTGCT
GGAGGTCCTGAAGTTCCTTTCCATCCGGGAAGGGAG
GTTAGTTTTGTTTTGTTTTGTTAACTTAATGTTTACTAACGGGCTTTTTTGTTCGTATGATTTCTATAATGTTATGATTTTAAC
GTTTTATGCCCTAATTGGATAACTTAAATTTGCTTCAGGACAAAGAAGAGCCCCCAGTTGAAGGCCGCCTTCCTGATGCAACTAAGGGTTAGTGAATCTGTTAACTCTGGACGTTCATCT
TGTGTATTGGAACATGATGATTATCTATTTATTTGATGTTTCTGGCTATTAATCATTTGTACCGTATTAAGATGTATCATCTGTATGTATTTCAGGAAACGACCATTTGAGGGATGTTTT
TGTTAAGACCATGGGTCTTGACGACATTGACATTGTGACACTATCTGGTGGCCACACTCTG
GTTGGTGTCGATAGTCACTACATTCATTATTTTCATTAGAATTTGCTTGAGCAAAATTT
TAACGTGTATTTTTTTATATAGGGGGCTGCCCACAAGGAGCGATCTGGATTTGAGGGACCATGGACTTCCAATCCCCTTGTCTTCGACAACAGCTACTTCACGTAAGATTTAGTTTTGGG
TTTATTGCAATTTATAGTTTTATACAAATCCTAAATTAGTTGTTGTAAACAGAGAGCTTCTTGCTGGTGAGAAAGAGGGTCTCCTCAAGCTACCTACCGACAAAGCTCTCCTTGAAGACC
CTGTATTCCGACCCCTGGTTGAGAAATATGCTGCT
GTGAGTACCTTTATAGCTTCAACCCTTGTAGGCTGCATTAGGTACTTGTATGCTTAATTTCGTTGTTTTGAATCAGGACGAGGAT
GCTTTCTTTGCCGACTATGCCGTCTCCCACATGAAACTCTCTGAGTTGGG
GTAAAGTTCAACTTTTGATATTTTATAAACACATGTTGACATTTGTGTGCAGAAATGAATGAAGTGTTAA
TTTGTATGTTTATGTCATGATCAACAGATTTGCTGAGGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTATCCATGTGTTAGTGAGGAGTACAAGAAGGCTGTTGACAAAGCCAGGAGGAAGCTCAGAGGATTTATTGCTGACAAGAGATGTGCTCCTTTGATGCTCCGTCTTGCA
TGGCACTCTGCTGGTACTTATGATGTGAACACCAAAAGCGGAGGTCCTTTCGGTACCATGAGGTACAAGGCTGAGTTGAGCCATGGTGCCAACAATGGTCTTGACATTGCTGTCAGGCTA
TTAGAGCCTATCAAGGAACAATTTCCCATCCTTTCATATGGTGATTTCTATCAG
TTGGCCGGTGTTGTTGCTGTCGAAATTGCTGGAGGTCCTGAAGTTCCTTTCCATCCGGGAAGGGAG
GACAAAGAAGAGCCCCCAGTTGAAGGCCGCCTTCCTGATGCAACTAAGGGAAACGACCATTTGAGGGATGTTTTTGTTAAGACCATGGGTCTTGACGACATTGACATTGTGACACTATCT
GGTGGCCACACTCTG
GGGGCTGCCCACAAGGAGCGATCTGGATTTGAGGGACCATGGACTTCCAATCCCCTTGTCTTCGACAACAGCTACTTCACAGAGCTTCTTGCTGGTGAGAAAGAG
GGTCTCCTCAAGCTACCTACCGACAAAGCTCTCCTTGAAGACCCTGTATTCCGACCCCTGGTTGAGAAATATGCTGCT
GACGAGGATGCTTTCTTTGCCGACTATGCCGTCTCCCACATG
AAACTCTCTGAGTTGGG
ATTTGCTGAGGCATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCGGGGATCG TTTCCTCGTT CTAGGGCTTA TCGATTCTTC AGATTCTTCA TCTTTTCATC CGATTTTAAC GGTTTAAAAC CATGGGGAAG AGCTATCCAT GTGTTAGTGA GGAGTACAAG  AAGGCTGTTG ACAAAGCCAG GAGGAAGCTC AGAGGATTTA TTGCTGACAA GAGATGTGCT CCTTTGATGC TCCGTCTTGC ATGGCACTCT GCTGGTACTT ATGATGTGAA CACCAAAAGC  GGAGGTCCTT TCGGTACCAT GAGGTACAAG GCTGAGTTGA GCCATGGTGC CAACAATGGT CTTGACATTG CTGTCAGGCT ATTAGAGCCT ATCAAGGAAC AATTTCCCAT CCTTTCATAT  GGTGATTTCT ATCAGTTGGC CGGTGTTGTT GCTGTTGAAA TTGCTGGAGG TCCTGAAGTT CCTTTCCATC CGGGAAGGGA GGACAAAGAA GAGCCCCCAG TTGAAGGCCG CCTTCCTGAT  GCAACTAAGG GAAACGACCA TTTGAGGGAT GTTTTTGTTA AGACCATGGG ACTTGACGAC ATTGACATTG TGACACTCTC TGGTGGCCAC ACTCTGGGAG CTGCCCACAA GGAGCGATCT  GGATTTGAGG GACCATGGAC TTCCAATCCC CTTATCTTCG ACAACAGCTA CTTCACAGAG CTTCTTGCTG GTGAGAAAGA GGGTCTCCTC AAGCTACCCA CCGACAAAGC TCTTCTTGAA  GACCCTGTAT TCCGACCCCT GGTTGAGAAA TATGCTGCTG ATGAGGATGC TTTCTTTGCC GACTATGCCG TCTCCCACAT GAAACTCTCT GAGTTGGGAT TTGCTGAGGC ATAAGGAGGA 
TTGTAAGAAA GGAGGGATGC TGCTACT 

Retrieve as FASTA