Entry information : MgrCcP02
Entry ID 2620
Creation 2006-07-21 (Nenad Bakalovic)
Last sequence changes 2006-07-21 (Nenad Bakalovic)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrCcP02
Name MgrCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgrCcP02
start..stop
S start..stop
MEspCcP02_NRRL54901 549 0 3..364 1..358
GgrCcP 546 0 3..364 1..362
NcCcP 529 0 5..360 2..354
StheCcP 528 0 3..363 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 250067..250568 502 N° 2 250665..251038 374 N° 3 251120..251338 219  
join(250067..250568,250665..251038,251120..251338)


exon

Literature and cross-references MgrCcP02
Literature REFERNECE 1 Madera, M. et al., The SUPERFAMILY database in 2004: additions and improvements, Nucl. Acids Res., 32, D235-D239.
REFERENCE 2 Dean,R.A., et al., The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434 (7036), 980-986 (2005)
DNA ref. JGI genome:   Supercontig_6.16 (250067..251338)
mRNA ref. GenBank:   XM_362100
Protein sequence: MgrCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364
PWM (Da):   %s   39965.82  
PI (pH):   %s   8.75
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQMASASRQILRAASRASTRTAFAPAASRGLAARTIAGRRFYSSSSEPAKASSSNLGWIAGALAAAAAGAGYWYTQNGGAATLTKPEFKDYQTVYNDIASRLEENPDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFSPEGGHGANAGLKAARDFLEPIKAKYPWITYSDLWILGGVCAIQEMLGPKIPYRPGRSDKDAAACTPDGRLPDAAQRQDHVRNIFYRMGFNDQEIVALAGAHALGRCHTDRSGFDGPWTFSPTVLTNDYFKLLLNEKWEYKKWDGPKYVDSKTKSLMMLPADMCLIEDKKFKEWTKKYADDNDLFFKDFSAAVLKLFELGVPFAEGTENQRWIFKPTSE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="70-15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGATGGCCTCTGCCTCTCGTCAGATCCTTCGGGCTGCGTCCCGCGCCAGCACCCGCACCGCGTTCGCCCCGGCTGCATCACGCGGCCTCGCCGCCCGCACCATCGCTGGCCGCCGC
TTCTACTCGTCTTCGTCCGAGCCCGCCAAGGCCTCGTCGTCCAACCTCGGCTGGATTGCCGGTGCCCTTGCCGCCGCTGCTGCTGGTGCCGGTTACTGGTACACCCAGAACGGTGGCGCC
GCCACGCTCACCAAGCCCGAGTTCAAGGACTACCAGACCGTGTACAACGACATTGCCAGCCGCCTCGAGGAGAACCCCGACTACGACGATGGTAGCTACGGCCCCGTCCTCGTGCGCCTG
GCTTGGCACGCTAGCGGTACCTACGACAAGGAGACCGGCACTGGCGGCAGCAACGGTGCCACCATGCGCTTCTCGCCTGAGGGTGGCCACGGTGCCAACGCTGGTCTGAAGGCCGCCCGT
GACTTCCTGGAGCCTATCAAGG
GTAAGCCACTGAGATCCTAGGAGTCCTTTGACGACGAGGGTGTGTCAAGGAATCTTGTCCCTTGCCCAAAAGCTAACGCATTGCCACAACCAACAGCC
AAGTACCCCTGGATCACCTACTCTGACCTCTGGATCCTTGGAGGCGTCTGCGCCATCCAGGAGATGCTGGGCCCCAAGATCCCTTACCGCCCTGGTCGCTCCGACAAGGACGCCGCTGCC
TGCACTCCCGACGGCCGCCTGCCCGACGCTGCCCAGCGCCAGGACCACGTCCGTAACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATCGTTGCCCTGGCCGGCGCTCACGCCCTG
GGCCGCTGCCACACCGACCGCAGCGGCTTCGACGGCCCCTGGACCTTTTCGCCTACCGTGCTGACCAACGACTACTTCAAGCTGCTGCTCAACGAGAAGTGGGAGTACAAGAAGTGGGAT
GGTCCTAAGCAG
GTGAGTTTTTGATATTTTTTTGTGAGAGGTGCTATAATGGCTTTGAAGCATGAGATTTCTGACCCTGGATGAACGAAACAGTACGTCGACAGCAAGACCAAGAGCCTC
ATGATGCTGCCCGCGGACATGTGCCTCATCGAGGACAAGAAGTTCAAGGAGTGGACCAAGAAGTACGCCGACGACAACGACCTGTTCTTCAAGGACTTCTCTGCCGCTGTGCTCAAGCTG
TTTGAGCTCGGTGTGCCGTTCGCCGAGGGTACCGAGAACCAGAGGTGGATCTTCAAGCCCACCAGCGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGATGGCCTCTGCCTCTCGTCAGATCCTTCGGGCTGCGTCCCGCGCCAGCACCCGCACCGCGTTCGCCCCGGCTGCATCACGCGGCCTCGCCGCCCGCACCATCGCTGGCCGCCGC
TTCTACTCGTCTTCGTCCGAGCCCGCCAAGGCCTCGTCGTCCAACCTCGGCTGGATTGCCGGTGCCCTTGCCGCCGCTGCTGCTGGTGCCGGTTACTGGTACACCCAGAACGGTGGCGCC
GCCACGCTCACCAAGCCCGAGTTCAAGGACTACCAGACCGTGTACAACGACATTGCCAGCCGCCTCGAGGAGAACCCCGACTACGACGATGGTAGCTACGGCCCCGTCCTCGTGCGCCTG
GCTTGGCACGCTAGCGGTACCTACGACAAGGAGACCGGCACTGGCGGCAGCAACGGTGCCACCATGCGCTTCTCGCCTGAGGGTGGCCACGGTGCCAACGCTGGTCTGAAGGCCGCCCGT
GACTTCCTGGAGCCTATCAAGG
CCAAGTACCCCTGGATCACCTACTCTGACCTCTGGATCCTTGGAGGCGTCTGCGCCATCCAGGAGATGCTGGGCCCCAAGATCCCTTACCGCCCTGGT
CGCTCCGACAAGGACGCCGCTGCCTGCACTCCCGACGGCCGCCTGCCCGACGCTGCCCAGCGCCAGGACCACGTCCGTAACATCTTCTACCGCATGGGCTTCAACGACCAGGAGATCGTT
GCCCTGGCCGGCGCTCACGCCCTGGGCCGCTGCCACACCGACCGCAGCGGCTTCGACGGCCCCTGGACCTTTTCGCCTACCGTGCTGACCAACGACTACTTCAAGCTGCTGCTCAACGAG
AAGTGGGAGTACAAGAAGTGGGATGGTCCTAAGCAG
TACGTCGACAGCAAGACCAAGAGCCTCATGATGCTGCCCGCGGACATGTGCCTCATCGAGGACAAGAAGTTCAAGGAGTGGACC
AAGAAGTACGCCGACGACAACGACCTGTTCTTCAAGGACTTCTCTGCCGCTGTGCTCAAGCTGTTTGAGCTCGGTGTGCCGTTCGCCGAGGGTACCGAGAACCAGAGGTGGATCTTCAAG
CCCACCAGCGAGTAA

Retrieve as FASTA