Entry information : MtPrx02 (Medtr5g074740.1[4.0] / Medtr5g074740.1[3.5] / Medtr5g082690.1[3.0])
Entry ID 266
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2010-09-14 (Haythem Mhadhbi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-07-15 (Christophe Dunand)
Peroxidase information: MtPrx02 (Medtr5g074740.1[4.0] / Medtr5g074740.1[3.5] / Medtr5g082690.1[3.0])
Name (synonym) MtPrx02 (Medtr5g074740.1[4.0] / Medtr5g074740.1[3.5] / Medtr5g082690.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Root tips
Seedling roots
Seedlings
Inducers Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Nitrogen starvation
Pathogen interaction
Rhizobium inoculation
Sinorhizobium inoculation
Repressor Glomus intraradices infection
Best BLASTp hits
Perox score E-value MtPrx02
start..stop
S start..stop
MtPrx70 644 0 1..322 1..322
MtPrx86 603 0 1..323 1..323
GmPrx40 509 0 1..321 1..329
GmPrx120 490 1e-176 6..321 5..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31762249..31762458 210 N° 2 31761372..31761566 195 N° 3 31760570..31761136 567  
complement(join(31760570..31761136,31761372..31761566,31762249..31762458))


exon

Literature and cross-references MtPrx02 (Medtr5g074740.1[4.0] / Medtr5g074740.1[3.5] / Medtr5g082690.1[3.0])
Literature Journet,E.P et al., unpublished
VandenBosch,K.et al., unpublished
Protein ref. UniProtKB:   G7KFK6
DNA ref. Phytozome 11:   chr5 (31762458..31760570)
Cluster/Prediction ref. Phytozome Gene 11:   31087850 UniGene:   Mtr.4408
Omic ref. Gene atlas:   Mtr.14639.1.S1_x_at Legoo:   Mtr.14639.1.S1_x_at
Protein sequence: MtPrx02 (Medtr5g074740.1[4.0] / Medtr5g074740.1[3.5] / Medtr5g082690.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 323 (300)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
35882.48 (33332.1) Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i7-29o
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.34 (9.34) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSRIQFVLFVVTFATILSPTIAKLTPNYYDRICPKALPIINSIVKQAIIREPRMGASLLRLHFHDCFVNGCDGSVLLDDTPTFIGEKTAFPNINSIRGFEVVDQIKEAVTKACKRDVVSCADILAIAARDSVAILGGKQYWYQVLLGRRDSRFASRDAANTNLPPPFFNFSQLITNFKSHGLNLKDLVVLSGGHTIGFSKCTNFRDRIFNDTNIDTNFAANLQKTCPKIGGDDNLAPFDSTPNKVDTSYYKALLYKRGLLHSDQELFKGDGSQSDRLVQLYSKNSYAFAYDFGVSMIKMGNLKPLTGKKGEIRCNCRKVNQI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, introns 1 and 2) and 19 ESTs. AC123575 contain 4 peroxidases (MtPrx01, 02, 70, 86) and one pseudogene.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCGTATCCAATTCGTGCTATTTGTGGTCACTTTTGCAACAATTTTGAGCCCTACCATTGCAAAACTGACTCCAAATTATTATGACAGAATTTGTCCCAAGGCATTGCCAATC
ATAAATTCAATTGTTAAGCAAGCAATTATTCGTGAGCCACGCATGGGAGCATCATTGCTACGTTTGCATTTCCATGACTGCTTTGTTAAC
GTAAGTTTGTTAATTTCATAAATTTATGAT
GCTATTTCTAGAATCATTAAGTAAAGTCAATATAATGTACATTCTCTAAATAAAAATGTTTGTAAATTATTGTTTATGTTAGTTTTGAGTGTTTAAACTTTATTTTTTGATATTTCTTAG
TCCCCCAACCAAGCTACATGCATTTCTTTTACACATTATTATTCAAACAACGTATATGAAAAAATAAAAGTTAAATTGTTGAAGGAAAAATAAAATTAGTTTCTAAAGGAACATAAATTA
ATTCATTATTTTTGTAGTAGTATAACTATATATTTGAGCAAGGCAATATCTAATATGAATAGTGGATATTTTACTCTTCTATTGATGTTTTTATATCTAATAATCATGTCAAACAATTAG
GTATCAATGGTGCAAGTTTGCAAGAAAAGTAGTTGGGTTCATGTTGTACTCATGCAAGAGACTTAAACTTTTTTGTATACTCTCTATAGAATTAGATGTAAAAATACAACAATAATTTTT
TGAAGGAAAAATACAACAATAATTAAAAAGCGATAATTTTGTAACATGCTAAAATATAGATCCTTCTTTATTCAAAATTTATATTTCTATATTAATTTCAAACTTATTATGAGTTAAATT
ATAAGTGCATCATATTCATGTCACAAATACATATGAACAATTTCCATTATAGGGTTGTGATGGATCGGTTCTGCTAGATGATACCCCTACCTTCATTGGTGAGAAGACTGCATTTCCAAA
TATCAATTCAATTAGAGGTTTTGAGGTTGTTGATCAAATTAAAGAAGCAGTTACCAAAGCTTGCAAACGCGATGTCGTATCATGCGCCGATATTTTAGCTATAGCTGCTCGAGACTCTGT
TGCCATT
GTAAGTCTTTCAAATATTTTTCACTTCTAAACAAGGTTTTAATTTGTGTAACCACAGTTGTTTCAGAAAATATAAAAGATTTTGAGGTCTATATATAACCGCAATTTTGAATA
CATAGACTGCATTTAACCGGATCAAAACTGAAATTTCGAGTAGTATATTTTTTTTATTGGTGAATTTGGAGTAGTATATATAACCCTAGCAACTAAGAAATTTTGCTTTCATCATTTAAC
AGCTGGGTGGTAAGCAATATTGGTACCAAGTGTTACTAGGAAGAAGAGATTCAAGATTTGCAAGCAGGGATGCAGCAAATACAAATCTTCCTCCTCCATTTTTCAATTTCTCACAACTCA
TCACAAATTTCAAGTCTCATGGACTTAACCTTAAAGACTTAGTTGTTCTATCTGGTGGCCACACAATTGGATTTTCCAAATGCACTAACTTTAGAGACAGGATCTTCAATGACACCAACA
TAGACACCAATTTTGCTGCCAATTTGCAAAAGACATGCCCTAAAATCGGCGGCGACGATAATTTAGCACCATTTGATTCTACACCTAACAAAGTTGACACATCATATTATAAGGCTTTGT
TGTATAAAAGGGGTCTTCTTCATTCTGATCAAGAGCTTTTTAAAGGTGATGGTTCTCAAAGTGATAGATTGGTTCAACTTTATAGTAAAAATTCTTATGCTTTTGCTTATGATTTTGGAG
TTTCTATGATTAAGATGGGTAACTTGAAGCCTCTTACTGGTAAAAAGGGTGAGATCAGGTGCAATTGCAGAAAAGTTAACCAGATATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCGTATCCAATTCGTGCTATTTGTGGTCACTTTTGCAACAATTTTGAGCCCTACCATTGCAAAACTGACTCCAAATTATTATGACAGAATTTGTCCCAAGGCATTGCCAATC
ATAAATTCAATTGTTAAGCAAGCAATTATTCGTGAGCCACGCATGGGAGCATCATTGCTACGTTTGCATTTCCATGACTGCTTTGTTAAC
GGTTGTGATGGATCGGTTCTGCTAGATGAT
ACCCCTACCTTCATTGGTGAGAAGACTGCATTTCCAAATATCAATTCAATTAGAGGTTTTGAGGTTGTTGATCAAATTAAAGAAGCAGTTACCAAAGCTTGCAAACGCGATGTCGTATCA
TGCGCCGATATTTTAGCTATAGCTGCTCGAGACTCTGTTGCCATT
CTGGGTGGTAAGCAATATTGGTACCAAGTGTTACTAGGAAGAAGAGATTCAAGATTTGCAAGCAGGGATGCAGCA
AATACAAATCTTCCTCCTCCATTTTTCAATTTCTCACAACTCATCACAAATTTCAAGTCTCATGGACTTAACCTTAAAGACTTAGTTGTTCTATCTGGTGGCCACACAATTGGATTTTCC
AAATGCACTAACTTTAGAGACAGGATCTTCAATGACACCAACATAGACACCAATTTTGCTGCCAATTTGCAAAAGACATGCCCTAAAATCGGCGGCGACGATAATTTAGCACCATTTGAT
TCTACACCTAACAAAGTTGACACATCATATTATAAGGCTTTGTTGTATAAAAGGGGTCTTCTTCATTCTGATCAAGAGCTTTTTAAAGGTGATGGTTCTCAAAGTGATAGATTGGTTCAA
CTTTATAGTAAAAATTCTTATGCTTTTGCTTATGATTTTGGAGTTTCTATGATTAAGATGGGTAACTTGAAGCCTCTTACTGGTAAAAAGGGTGAGATCAGGTGCAATTGCAGAAAAGTT
AACCAGATATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTGCTCAAA TTATAGTCTC ATATACACAA GCATAGAGTA AAATGGATTC TCGTATCCAA TTCGTGCTAT TTGTGGTCAC TTTTGCAACA ATTTTGAGCC CTACCATTGC AAAACTGACT  CCAAATTATT ATGACAGAAT TTGTCCCAAG GCATTGCCAA TCATAAATTC AATTGTTAAG CAAGCAATTA TTCGTGAGCC ACGCATGGGA GCATCATTGC TACGTTTGCA TTTCCATGAC  TGCTTTGTTA ACGGTTGTGA TGGATCGGTT CTGCTAGATG ATACCCCTAC CTTCATTGGT GAGAAGACTG CATTTCCAAA TATCAATTCA ATTAGAGGTT TTGAGGTTGT TGATCAAATT  AAAGAAGCAG TTACCAAAGC TTGCAAACGC GATGTCGTAT CATGCGCCGA TATTTTAGCT ATAGCTGCTC GAGACTCTGT TGCCATTCTG GGTGGTAAGC AATATTGGTA CCAAGTGTTA  CTAGGAAGAA GAGATTCAAG ATTTGCAAGC AGGGATGCAG CAAATACAAA TCTTCCTCCT CCATTTTTCA ATTTCTCACA ACTCATCACA AATTTCAAGT CTCATGGACT TAACCTTAAA  GACTTAGTTG TTCTATCTGG TGGCCACACA ATTGGATTTT CCAAATGCAC TAACTTTAGA GACAGGATCT TCAATGACAC CAACATAGAC ACCAATTTTG CTGCCAATTT GCAAAAGACA  TGCCCTAAAA TCGGCGGCGA CGATAATTTA GCACCATTTG ATTCTACACC TAACAAAGTT GACACATCAT ATTATAAGGC TTTGTTGTAT AAAAGGGGTC TTCTTCATTC TGATCAAGAG  CTTTTTAAAG GTGATGGTTC TCAAAGTGAT AGATTGGTTC AACTTTATAG TAAAAATTCT TATGCTTTTG CTTATGATTT TGGAGTTTCT ATGATTAAGA TGGGTAACTT GAAGCCTCTT  ACTGGTAAAA AGGGTGAGAT CAGGTGCAAT TGCAGAAAAG TTAACCAGAT ATGAATGAAG AAGGATAATG ATTGATTAAT TGTTTAATAT AAAGTTGAGG GAATTTTTTT ATATTTTCTA  TAAATTATCA AAATATGTTG ATTGTTGAGA ATAAGAATTC TAGGTTCAAA ACAGAATCTT GAATTGTCAA GGAGTCTGTT AAATGTGAGA TTTATTATTA TGTTTCATTT CAAAAGTATT 
AAGTTTTATT TGTGTGACTA TTTGGATTGT GATTATTGCT AAATGTTTAT ACGTATTAAA ATTTGCATGC TTTTTGTCCC ACTCAAATAA AAATTAATTA GTATTGCTTG CTTCC 

Retrieve as FASTA