Entry information : SbPrx18 (Sobic.001G379400.1[2.1] / SB01G036000[1.4])
Entry ID 2720
Creation 2006-02-22 (Christophe Dunand)
Last sequence changes 2011-01-27 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx18 (Sobic.001G379400.1[2.1] / SB01G036000[1.4])
Name (synonym) SbPrx18 (Sobic.001G379400.1[2.1] / SB01G036000[1.4])
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx18
start..stop
S start..stop
SofPrx11 625 0 9..327 1..319
ZmPrx120 570 0 22..327 16..321
SiPrx165 560 0 15..327 1..313
OsPrx40 524 0 22..326 15..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59660390..59660608 219 N° 2 59660037..59660231 195 N° 3 59659338..59659907 570  
complement(join(59659338..59659907,59660037..59660231,59660390..59660608))


exon

Literature and cross-references SbPrx18 (Sobic.001G379400.1[2.1] / SB01G036000[1.4])
Literature Plant Genome Database
DNA ref. Phytozome 11:   chromosome_1 (59660608..59659339)
Protein sequence: SbPrx18 (Sobic.001G379400.1[2.1] / SB01G036000[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   34384.28 (31802.9) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.95 (7.41) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRRFVAAACVVATVAFALLASTSSAQLDPHFYDKACPAALPTIKRLVQEAVAAEPRMGASLLRLHFHDCFVNGCDGSILLDDTPFFTGEKMAAPNANSVRGFDVIDRIKGAVNAACRGNVVSCADIVAVAARDSVVALGGPSYNVPLGRRDARTASQAAANNSIPAPTFSLDRLASNFASHGLSLQDLVVLSGGHTLGFARCTNFRDRLYNETATLDGSLAASLRAVCPRATGSGDDSLAPLDPTPARFDGAYFASLLRSRGVLHSDQQLFAGGLGVTDALVRFYAANADAFRRDFAEAMVRMASLSSLTGSSGEIRYDCRKVNYS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No EST. Uncorect prediction from Phytozome (missing intron 3, bad exon 3)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCGCCGTTTCGTGGCGGCGGCGTGTGTCGTCGCGACCGTGGCGTTCGCTCTCTTGGCCTCGACCAGCAGCGCGCAGCTGGACCCGCACTTCTACGACAAGGCGTGCCCCGCGGCT
CTCCCCACCATCAAGAGGCTCGTGCAGGAGGCTGTGGCGGCGGAGCCCCGCATGGGCGCGTCGCTGCTGCGGCTGCACTTCCACGACTGCTTCGTCAAC
GTACGCACGCACGCAGATGCA
TGCATTACTAGCTAGCAGTCACGTCTCACGCTGATGCAGTGATGCATCCGGCCGTGCATTTCGACTCCTCTCTCGACATCGTCTGTGCGCGCGCGTTTAATTACGTGTCTCCGATCTTAT
CTTTGTGCTTGGTTCAGGGGTGCGACGGGTCCATCCTGCTCGACGACACGCCCTTCTTCACCGGCGAGAAGATGGCCGCGCCCAACGCCAACTCCGTCCGCGGCTTCGACGTGATCGACC
GCATCAAGGGCGCCGTCAACGCCGCCTGCAGGGGCAATGTGGTCTCCTGTGCCGACATCGTCGCCGTCGCGGCACGTGACTCCGTCGTCGCG
GTTCGTTCGTTTCACCTCCCTCGTCTTG
TTGCACGCACCAAAACCTTCACCCGTCCAGCGCATGCATGCGTGAAACTGAAATGTGAATGCGTCGTGATCCTTTTCCCACCCACGTCCATGCATGCGCAGCTGGGAGGCCCGTCGTACA
ACGTGCCGCTGGGCCGCCGGGACGCGCGGACGGCGAGCCAGGCGGCGGCGAACAACAGCATCCCGGCGCCGACCTTCAGCCTGGACCGCCTCGCCTCCAACTTCGCGTCGCACGGCCTCT
CCCTCCAGGACCTCGTCGTGCTGTCCGGAGGCCACACGCTGGGCTTCGCCCGCTGCACAAACTTCCGGGACCGCCTCTACAACGAGACCGCCACCCTGGACGGCTCCCTCGCCGCCTCGC
TGCGGGCCGTGTGCCCGCGCGCCACCGGCAGCGGCGACGACAGCCTCGCGCCGCTCGACCCCACGCCGGCGCGATTCGACGGCGCCTACTTCGCCTCGCTGCTGCGGAGCAGGGGAGTCC
TCCACTCCGACCAGCAGCTGTTCGCCGGCGGGCTCGGCGTCACGGACGCTCTCGTCAGGTTCTACGCCGCGAACGCCGACGCGTTCAGGAGGGACTTCGCGGAGGCCATGGTGAGGATGG
CCAGCCTGAGCTCGCTCACCGGGAGCAGCGGCGAGATCCGCTACGACTGCAGGAAAGTGAACTACTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCGCCGTTTCGTGGCGGCGGCGTGTGTCGTCGCGACCGTGGCGTTCGCTCTCTTGGCCTCGACCAGCAGCGCGCAGCTGGACCCGCACTTCTACGACAAGGCGTGCCCCGCGGCT
CTCCCCACCATCAAGAGGCTCGTGCAGGAGGCTGTGGCGGCGGAGCCCCGCATGGGCGCGTCGCTGCTGCGGCTGCACTTCCACGACTGCTTCGTCAAC
GGGTGCGACGGGTCCATCCTG
CTCGACGACACGCCCTTCTTCACCGGCGAGAAGATGGCCGCGCCCAACGCCAACTCCGTCCGCGGCTTCGACGTGATCGACCGCATCAAGGGCGCCGTCAACGCCGCCTGCAGGGGCAAT
GTGGTCTCCTGTGCCGACATCGTCGCCGTCGCGGCACGTGACTCCGTCGTCGCG
CTGGGAGGCCCGTCGTACAACGTGCCGCTGGGCCGCCGGGACGCGCGGACGGCGAGCCAGGCGGCG
GCGAACAACAGCATCCCGGCGCCGACCTTCAGCCTGGACCGCCTCGCCTCCAACTTCGCGTCGCACGGCCTCTCCCTCCAGGACCTCGTCGTGCTGTCCGGAGGCCACACGCTGGGCTTC
GCCCGCTGCACAAACTTCCGGGACCGCCTCTACAACGAGACCGCCACCCTGGACGGCTCCCTCGCCGCCTCGCTGCGGGCCGTGTGCCCGCGCGCCACCGGCAGCGGCGACGACAGCCTC
GCGCCGCTCGACCCCACGCCGGCGCGATTCGACGGCGCCTACTTCGCCTCGCTGCTGCGGAGCAGGGGAGTCCTCCACTCCGACCAGCAGCTGTTCGCCGGCGGGCTCGGCGTCACGGAC
GCTCTCGTCAGGTTCTACGCCGCGAACGCCGACGCGTTCAGGAGGGACTTCGCGGAGGCCATGGTGAGGATGGCCAGCCTGAGCTCGCTCACCGGGAGCAGCGGCGAGATCCGCTACGAC
TGCAGGAAAGTGAACTACTCTTGA

Retrieve as FASTA