Entry information : SbPrx133 (Sobic.010G149700.1 [2.1] / SB10G020100 [1.4])
Entry ID 2721
Creation 2006-01-13 (Christophe Dunand)
Last sequence changes 2006-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx133 (Sobic.010G149700.1 [2.1] / SB10G020100 [1.4])
Name (synonym) SbPrx133 (Sobic.010G149700.1 [2.1] / SB10G020100 [1.4])
Class Class III peroxidase    [Orthogroup: Prx080]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx133
start..stop
S start..stop
ZmPrx117 550 0 1..328 1..323
SiPrx40 492 5e-177 1..329 1..327
SiPrx28 460 2e-164 1..329 1..330
SiPrx41 456 1e-162 1..329 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43072197..43072424 228 N° 2 43071337..43072098 762  
complement(join(43071337..43072098,43072197..43072424))


exon

Literature and cross-references SbPrx133 (Sobic.010G149700.1 [2.1] / SB10G020100 [1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_10 (43072424..43071337)
Protein sequence: SbPrx133 (Sobic.010G149700.1 [2.1] / SB10G020100 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (301)
PWM (Da):   %s   35229.26 (32302.7) Transmb domain:   %s   i7-26o
PI (pH):   %s   6.34 (6.17) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSPSTRSCSWLVLVPLILSILLACTANGDHLKVGYYDNTCPNVQQIVHSVMASRVDADQSMAPAVLRLFFHDCFVDGCDGSVLLDGTPFSGSEKDAKPNANSLRGFDVIDEIKSHVEHACPATVSCADILALASRDAVALLGGPTWEVQLGRRDSRGANRTAAEYGLPAPNSTLAELIGLFRHHGLDARDMAALSGAHTIGTARCHHYRNRAYGYGGEGGAAAIDPAFAERRRQTCQSAYDAPAPFDEQTPMGFDNAYYRDLVARRGLLTSDQALYGGGGPLDNLVEMYSTDGKAFAKDFARAMVKMGKIPPPPQMQVEVRLSCSNINW*

Retrieve as FASTA  
Remarks Complete sequence from only genomic (chromo 10, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGCCTTCCACCAGGAGCTGTTCATGGCTTGTTCTTGTTCCCCTGATCCTCTCGATTCTTCTCGCGTGCACTGCCAACGGCGACCATCTAAAGGTGGGCTACTACGACAATACGTGC
CCCAACGTGCAGCAGATCGTGCACTCCGTGATGGCGTCCAGGGTCGACGCCGACCAGTCGATGGCGCCCGCCGTGCTCCGCCTCTTCTTCCACGACTGCTTCGTCGAC
GTACGTACGCCC
CCAATTTCACCGATCTAATTCCTTCCTAGTCTAATCTTTACTTGTGTTTCTGCATTGTGTCCTAAAGTTTTTTTTTTGTACGGCAGGGGTGCGACGGCTCCGTCCTACTGGACGGGACGC
CCTTCTCCGGGAGCGAGAAGGACGCCAAGCCCAACGCCAACTCGCTCCGGGGCTTCGACGTGATCGACGAGATCAAGTCCCACGTCGAGCATGCCTGCCCGGCCACGGTCTCCTGCGCCG
ACATCCTCGCGCTCGCCTCCCGCGACGCCGTCGCGCTGCTCGGGGGCCCGACGTGGGAAGTGCAGCTCGGCCGCAGGGACTCGCGCGGCGCCAACAGGACCGCCGCCGAGTACGGTCTCC
CAGCCCCGAACTCCACCCTCGCCGAGCTCATTGGCCTGTTCAGGCACCACGGCCTCGACGCGCGCGACATGGCGGCGCTCTCCGGCGCGCACACCATCGGCACGGCGCGGTGCCACCACT
ACAGGAACCGAGCCTACGGCTACGGCGGCGAGGGCGGCGCCGCCGCCATCGACCCCGCGTTCGCGGAGCGGCGCAGGCAGACGTGCCAGTCCGCTTATGACGCGCCGGCGCCGTTCGACG
AGCAGACCCCGATGGGGTTCGACAACGCCTACTACCGGGACCTCGTGGCGCGGCGCGGCCTCCTCACCTCCGACCAGGCGCTCTACGGCGGCGGTGGACCGCTGGACAATCTGGTGGAAA
TGTACAGCACGGACGGCAAGGCGTTCGCCAAGGATTTTGCCAGGGCAATGGTGAAGATGGGCAAAATACCACCGCCACCACAGATGCAGGTGGAGGTCAGACTCAGCTGCAGTAACATCA
ACTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGCCTTCCACCAGGAGCTGTTCATGGCTTGTTCTTGTTCCCCTGATCCTCTCGATTCTTCTCGCGTGCACTGCCAACGGCGACCATCTAAAGGTGGGCTACTACGACAATACGTGC
CCCAACGTGCAGCAGATCGTGCACTCCGTGATGGCGTCCAGGGTCGACGCCGACCAGTCGATGGCGCCCGCCGTGCTCCGCCTCTTCTTCCACGACTGCTTCGTCGAC
GGGTGCGACGGC
TCCGTCCTACTGGACGGGACGCCCTTCTCCGGGAGCGAGAAGGACGCCAAGCCCAACGCCAACTCGCTCCGGGGCTTCGACGTGATCGACGAGATCAAGTCCCACGTCGAGCATGCCTGC
CCGGCCACGGTCTCCTGCGCCGACATCCTCGCGCTCGCCTCCCGCGACGCCGTCGCGCTGCTCGGGGGCCCGACGTGGGAAGTGCAGCTCGGCCGCAGGGACTCGCGCGGCGCCAACAGG
ACCGCCGCCGAGTACGGTCTCCCAGCCCCGAACTCCACCCTCGCCGAGCTCATTGGCCTGTTCAGGCACCACGGCCTCGACGCGCGCGACATGGCGGCGCTCTCCGGCGCGCACACCATC
GGCACGGCGCGGTGCCACCACTACAGGAACCGAGCCTACGGCTACGGCGGCGAGGGCGGCGCCGCCGCCATCGACCCCGCGTTCGCGGAGCGGCGCAGGCAGACGTGCCAGTCCGCTTAT
GACGCGCCGGCGCCGTTCGACGAGCAGACCCCGATGGGGTTCGACAACGCCTACTACCGGGACCTCGTGGCGCGGCGCGGCCTCCTCACCTCCGACCAGGCGCTCTACGGCGGCGGTGGA
CCGCTGGACAATCTGGTGGAAATGTACAGCACGGACGGCAAGGCGTTCGCCAAGGATTTTGCCAGGGCAATGGTGAAGATGGGCAAAATACCACCGCCACCACAGATGCAGGTGGAGGTC
AGACTCAGCTGCAGTAACATCAACTGGTGA

Retrieve as FASTA