Entry information : SbPrx126 (Sobic.009G186500.1 [2.1] / SB09G024580 [1.4])
Entry ID 2723
Creation 2006-01-13 (Christophe Dunand)
Last sequence changes 2006-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx126 (Sobic.009G186500.1 [2.1] / SB09G024580 [1.4])
Name (synonym) SbPrx126 (Sobic.009G186500.1 [2.1] / SB09G024580 [1.4])
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx126
start..stop
S start..stop
SiPrx96 590 0 1..326 1..326
ZmPrx88 569 0 23..326 20..323
OsPrx74 558 0 1..326 1..326
BdiPrx73 539 0 1..326 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 54120899..54121105 207 N° 2 54121218..54121406 189 N° 3 54121526..54122110 585  
join(54120899..54121105,54121218..54121406,54121526..54122110)


exon

Literature and cross-references SbPrx126 (Sobic.009G186500.1 [2.1] / SB09G024580 [1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_9 (54120899..54122110)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.11829.1
Protein sequence: SbPrx126 (Sobic.009G186500.1 [2.1] / SB09G024580 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (304)
PWM (Da):   %s   35245.87 (33175.7)  
PI (pH):   %s   7.74 (7.41) Peptide Signal:   %s   cut: 23 range:23-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRAALLALLLSAFAAASAVAQLDEKFYSQSCPSVEDVVRKEMVRALSVAPSLAGPLLRMHFHDCFVRGCDGSVLLDSTANNTAEKDAKPNLTLRGFSFIETVKAAVEKACPDTVSCADLLALMARDAVWLSKGPFWAVPLGRRDGRVSIANETKQLPPPTGNFTKLTQLFGAKNLDTKDLVVLSAGHTIGTSHCFSFSDRLYNFTGLDNARDIDPTLDLAYMARLRGKCTSLDDNTTLVEMDPGSFKTFDLSYFANVAKRRGLFHSDGALLTDPTTRAYVLRHATGNYKEEFFADFAASMLKMGAVDVLTGSQGEIRKKCSVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCAGGGCGGCTCTCCTGGCGCTTCTGCTCTCGGCGTTCGCGGCGGCGTCGGCGGTGGCGCAGCTGGACGAGAAGTTCTACAGCCAGTCGTGCCCCAGCGTGGAGGATGTCGTC
CGGAAGGAGATGGTGCGCGCGCTCTCCGTCGCGCCCAGCCTCGCCGGCCCCCTCCTCAGGATGCACTTCCACGACTGCTTCGTCAGG
GTACGTGCATTATTGCATTTTGTGGTTTCGTCA
GGGATCGACTTGAGCTGGCTCGATCGGCTTTGCTAACCCCGTTGCTGCATCCTGCATTGCTCGCCGCCGATCGGTGCAGGGGTGCGACGGCTCCGTCCTCCTTGACTCCACGGCGAACAA
CACCGCGGAGAAGGACGCGAAGCCGAACCTGACGCTGCGCGGCTTCAGCTTCATCGAGACGGTCAAGGCCGCCGTGGAGAAGGCGTGCCCTGACACCGTCTCCTGCGCCGACTTGCTGGC
CCTCATGGCCAGGGACGCCGTGTGGCTG
GTGAGCAACCGATCGATCGAGCACTGCATGCACGCACGCACGCACACCATTGTTCCACAATTCATTACAGCGCAACTGTTCTTACTGGCTGG
TTGTTTTGCACGCACGCACGCACGCAGAGCAAGGGCCCGTTCTGGGCGGTCCCTCTGGGGCGGCGAGACGGCAGGGTGTCCATCGCCAACGAGACCAAGCAGCTGCCGCCGCCGACGGGC
AACTTCACGAAGCTGACCCAGCTGTTCGGCGCCAAGAACCTGGACACCAAGGACCTGGTGGTGCTGTCCGCCGGCCACACCATCGGCACGTCGCACTGCTTCTCCTTCTCGGACCGGCTC
TACAACTTCACGGGGCTGGACAACGCCCGCGACATCGACCCGACGCTGGACCTGGCGTACATGGCGCGGCTCCGCGGCAAGTGCACGAGCCTGGACGACAACACCACGCTGGTGGAGATG
GACCCAGGGAGCTTCAAGACCTTCGACCTGAGCTACTTCGCCAACGTGGCCAAGCGCAGGGGCCTCTTCCACTCCGACGGCGCGCTGCTCACCGACCCCACCACCCGCGCCTACGTGCTC
CGCCACGCCACGGGGAACTACAAGGAGGAGTTCTTCGCCGACTTCGCCGCGTCCATGCTCAAGATGGGCGCCGTCGACGTGCTCACCGGCAGCCAGGGAGAGATCAGGAAGAAGTGCAGC
GTCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCAGGGCGGCTCTCCTGGCGCTTCTGCTCTCGGCGTTCGCGGCGGCGTCGGCGGTGGCGCAGCTGGACGAGAAGTTCTACAGCCAGTCGTGCCCCAGCGTGGAGGATGTCGTC
CGGAAGGAGATGGTGCGCGCGCTCTCCGTCGCGCCCAGCCTCGCCGGCCCCCTCCTCAGGATGCACTTCCACGACTGCTTCGTCAGG
GGGTGCGACGGCTCCGTCCTCCTTGACTCCACG
GCGAACAACACCGCGGAGAAGGACGCGAAGCCGAACCTGACGCTGCGCGGCTTCAGCTTCATCGAGACGGTCAAGGCCGCCGTGGAGAAGGCGTGCCCTGACACCGTCTCCTGCGCCGAC
TTGCTGGCCCTCATGGCCAGGGACGCCGTGTGGCTG
AGCAAGGGCCCGTTCTGGGCGGTCCCTCTGGGGCGGCGAGACGGCAGGGTGTCCATCGCCAACGAGACCAAGCAGCTGCCGCCG
CCGACGGGCAACTTCACGAAGCTGACCCAGCTGTTCGGCGCCAAGAACCTGGACACCAAGGACCTGGTGGTGCTGTCCGCCGGCCACACCATCGGCACGTCGCACTGCTTCTCCTTCTCG
GACCGGCTCTACAACTTCACGGGGCTGGACAACGCCCGCGACATCGACCCGACGCTGGACCTGGCGTACATGGCGCGGCTCCGCGGCAAGTGCACGAGCCTGGACGACAACACCACGCTG
GTGGAGATGGACCCAGGGAGCTTCAAGACCTTCGACCTGAGCTACTTCGCCAACGTGGCCAAGCGCAGGGGCCTCTTCCACTCCGACGGCGCGCTGCTCACCGACCCCACCACCCGCGCC
TACGTGCTCCGCCACGCCACGGGGAACTACAAGGAGGAGTTCTTCGCCGACTTCGCCGCGTCCATGCTCAAGATGGGCGCCGTCGACGTGCTCACCGGCAGCCAGGGAGAGATCAGGAAG
AAGTGCAGCGTCGTCAACTAA

Retrieve as FASTA