Entry information : SbPrx78 (Sobic.004G146700.1 [2.1] / SB04G019270 [1.4])
Entry ID 2726
Creation 2010-01-11 (Christophe Dunand)
Last sequence changes 2010-01-11 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx78 (Sobic.004G146700.1 [2.1] / SB04G019270 [1.4])
Name (synonym) SbPrx78 (Sobic.004G146700.1 [2.1] / SB04G019270 [1.4])
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx78
start..stop
S start..stop
SiPrx22 575 0 11..391 9..367
ZmPrx100 550 0 1..387 1..378
OsPrx18 498 1e-177 15..387 12..365
BdiPrx93 496 2e-177 7..388 5..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45056463..45056813 351 N° 2 45055530..45056354 825  
complement(join(45055530..45056354,45056463..45056813))


exon

Literature and cross-references SbPrx78 (Sobic.004G146700.1 [2.1] / SB04G019270 [1.4])
Literature Plant Genome Database.
DNA ref. Phytozome 11:   chromosome_4 (45056813..45055530)
Protein sequence: SbPrx78 (Sobic.004G146700.1 [2.1] / SB04G019270 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   391 (368)
PWM (Da):   %s   41541.08 (39230.8)  
PI (pH):   %s   5.13 (4.92) Peptide Signal:   %s   cut: 24 range:24-391
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLGTPARRAICLLAAVSIVLSTVSLRCDASRSSADFSPDDDDYGHDENGGNSSSSSFSFTFQPETSSPGLVFGFYDETCPDAEDIISSTMRKLYHSDPNVAAALVRLFFHDCFIHGCDASVLLDVVDGGRKSERDAGPNQSLRGMSAIEEIKRRVEAACPRTVSCADILALAARDSVVLVGGPTYPVLTGRRDSAQSFYHDAAAGGIPSPNATYGMTLAAFARHGREFTERETVALLGAHSIGKVRCRFFADRIWNFAGTGAPDDSIDPDMVGEMRAVCGGSGGDDGDGDDDGAAAMEMGYYRQGREVGFGAHYYARLLEGRGILRADQQLTAGSTVRWVRVYASGARGEEVFREDFAHAMVKLSGLAPLTGSAGQIRISCSKPVVHDN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCGTTAGGAACTCCGGCACGTAGAGCCATCTGCTTGCTAGCTGCTGTGTCCATCGTCCTTAGCACGGTCAGTCTCCGTTGCGATGCCAGCAGGTCCTCCGCCGATTTCTCACCT
GACGATGATGACTATGGACACGACGAGAACGGCGGCAACTCATCCTCCTCCTCCTTCTCGTTCACCTTCCAGCCGGAGACGAGTTCACCCGGTCTGGTCTTCGGGTTCTACGACGAGACA
TGCCCGGACGCCGAGGACATCATCTCGTCCACGATGCGCAAGCTCTACCACTCCGACCCCAACGTCGCCGCTGCGCTCGTCCGCCTCTTCTTCCACGACTGCTTCATCCAC
GTACGTCAA
AACCAACCAAACAATCTCCATGTCATCCTCCGTCTCACCATCTTTACCTACGACGACGCTCACACGCGCACACGCCAAGACATTGTCGACGGTGTGCAGGGCTGCGACGCCTCGGTGCTG
CTGGACGTCGTCGACGGCGGCCGGAAATCAGAGCGCGACGCCGGGCCAAACCAGTCGCTACGAGGCATGAGCGCCATCGAGGAGATCAAGCGGAGAGTGGAGGCAGCGTGTCCAAGAACC
GTCTCCTGCGCGGACATCCTGGCGCTCGCCGCGCGAGACAGCGTCGTCCTCGTCGGCGGACCAACCTACCCGGTCCTCACGGGCCGCCGCGACAGCGCGCAGAGCTTCTACCACGACGCC
GCCGCCGGCGGCATCCCGTCGCCGAACGCCACGTACGGCATGACGCTGGCAGCGTTCGCGCGGCACGGGCGGGAGTTCACGGAGCGGGAGACCGTCGCGCTGTTAGGAGCGCACAGCATC
GGGAAGGTGCGGTGCAGGTTCTTCGCCGACAGGATCTGGAACTTCGCCGGCACCGGCGCGCCTGACGACTCCATTGATCCGGACATGGTCGGCGAGATGCGCGCGGTGTGCGGCGGCAGC
GGCGGCGATGATGGCGATGGCGACGACGACGGTGCGGCGGCGATGGAGATGGGGTATTACAGGCAGGGACGGGAGGTGGGATTCGGCGCGCACTACTACGCGAGGTTGTTGGAAGGCCGC
GGCATCCTGCGCGCCGACCAGCAGCTCACCGCCGGGAGCACCGTGCGGTGGGTGCGCGTGTACGCGTCTGGAGCGCGTGGGGAGGAGGTGTTCCGTGAGGACTTTGCGCACGCCATGGTT
AAGCTGTCGGGGCTCGCGCCACTCACGGGGTCAGCTGGGCAGATACGGATTAGCTGCTCCAAACCTGTTGTCCATGATAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCGTTAGGAACTCCGGCACGTAGAGCCATCTGCTTGCTAGCTGCTGTGTCCATCGTCCTTAGCACGGTCAGTCTCCGTTGCGATGCCAGCAGGTCCTCCGCCGATTTCTCACCT
GACGATGATGACTATGGACACGACGAGAACGGCGGCAACTCATCCTCCTCCTCCTTCTCGTTCACCTTCCAGCCGGAGACGAGTTCACCCGGTCTGGTCTTCGGGTTCTACGACGAGACA
TGCCCGGACGCCGAGGACATCATCTCGTCCACGATGCGCAAGCTCTACCACTCCGACCCCAACGTCGCCGCTGCGCTCGTCCGCCTCTTCTTCCACGACTGCTTCATCCAC
GGCTGCGAC
GCCTCGGTGCTGCTGGACGTCGTCGACGGCGGCCGGAAATCAGAGCGCGACGCCGGGCCAAACCAGTCGCTACGAGGCATGAGCGCCATCGAGGAGATCAAGCGGAGAGTGGAGGCAGCG
TGTCCAAGAACCGTCTCCTGCGCGGACATCCTGGCGCTCGCCGCGCGAGACAGCGTCGTCCTCGTCGGCGGACCAACCTACCCGGTCCTCACGGGCCGCCGCGACAGCGCGCAGAGCTTC
TACCACGACGCCGCCGCCGGCGGCATCCCGTCGCCGAACGCCACGTACGGCATGACGCTGGCAGCGTTCGCGCGGCACGGGCGGGAGTTCACGGAGCGGGAGACCGTCGCGCTGTTAGGA
GCGCACAGCATCGGGAAGGTGCGGTGCAGGTTCTTCGCCGACAGGATCTGGAACTTCGCCGGCACCGGCGCGCCTGACGACTCCATTGATCCGGACATGGTCGGCGAGATGCGCGCGGTG
TGCGGCGGCAGCGGCGGCGATGATGGCGATGGCGACGACGACGGTGCGGCGGCGATGGAGATGGGGTATTACAGGCAGGGACGGGAGGTGGGATTCGGCGCGCACTACTACGCGAGGTTG
TTGGAAGGCCGCGGCATCCTGCGCGCCGACCAGCAGCTCACCGCCGGGAGCACCGTGCGGTGGGTGCGCGTGTACGCGTCTGGAGCGCGTGGGGAGGAGGTGTTCCGTGAGGACTTTGCG
CACGCCATGGTTAAGCTGTCGGGGCTCGCGCCACTCACGGGGTCAGCTGGGCAGATACGGATTAGCTGCTCCAAACCTGTTGTCCATGATAACTGA

Retrieve as FASTA