Entry information : SbPrx103 ( Sobic.007G098600.1 [2.1] / SB07G010450 [1.4])
Entry ID 2732
Creation 2006-01-13 (Christophe Dunand)
Last sequence changes 2006-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx103 ( Sobic.007G098600.1 [2.1] / SB07G010450 [1.4])
Name (synonym) SbPrx103 ( Sobic.007G098600.1 [2.1] / SB07G010450 [1.4])
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx103
start..stop
S start..stop
ZmPrx32 637 0 1..371 1..368
SiPrx68 563 0 1..371 1..358
TaPrx22-1A 528 0 29..369 22..348
BdiPrx105 513 0 31..369 27..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18949675..18949992 318 N° 2 18950124..18950315 192 N° 3 18950463..18950628 166 N° 4 18950782..18951224 443
join(18949675..18949992,18950124..18950315,18950463..18950628,18950782..18951224 )


exon

Literature and cross-references SbPrx103 ( Sobic.007G098600.1 [2.1] / SB07G010450 [1.4])
Literature Plant genome Database.
DNA ref. Phytozome 12:   chromosome_7 (18949675..18951224)
Protein sequence: SbPrx103 ( Sobic.007G098600.1 [2.1] / SB07G010450 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (347)
PWM (Da):   %s   38003.26 (35414.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.65 (5.17) Peptide Signal:   %s   cut: 26 range:26-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHSTTLALHLLVVVVMALIFVASASVSAPVNKSCVTGSAGASVSIGYGGARASAGAGVSLGADAYRTTCPRAEEVVRAAVEWAVAADPRMAASLLRLHFHDCFVNGCDGSVLLDDKPFLVGEKTAVPNANSLRGFEVIDAIKAELERECPETVSCADLLAIAARDSVVVSGGPSWEVEVGRKDSRTASLQGANTNLPAPTSGVATLVQKFRNVGLSAKDMVALSGAHTIGKARCTSFSARLAGVGGVSEGGVGAFKDLTFLQSLQQLCTGSAGSALAHLDLTTPATFDNQYYINLLSGDGLLPSDQALASSSGVAPGVEADVASLVAIYAFDASVFFQDFAESMLRMGRLAPGAGTSGEVRRNCRVVNISG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTCCACCACCTTGGCCCTGCACCTGCTGGTCGTCGTCGTGATGGCGCTCATCTTTGTTGCCTCGGCCAGTGTCTCCGCTCCCGTCAACAAGTCGTGCGTCACCGGTAGCGCC
GGCGCCAGTGTGAGCATTGGCTACGGCGGGGCAAGGGCCAGCGCCGGCGCTGGCGTGTCCCTTGGTGCCGACGCGTACAGGACCACCTGCCCCCGCGCCGAGGAGGTCGTCCGTGCGGCC
GTTGAGTGGGCCGTCGCTGCCGACCCACGCATGGCTGCGTCTCTCCTGCGCCTCCATTTCCACGACTGCTTCGTCAAC
GTAATAGGAGTTGATCAAGCGATCGAGCTAGCTCCTCCAACT
CGAAACCACACACACATGGTCGATCGATCTGCATGCTTTATATATATATTTCTGTGACTTGGCTGCCTGCTGTTTTAATCTGTTGTCAGGGTTGTGATGGCTCCGTTCTTCTGGACGACA
AGCCGTTTCTCGTTGGCGAGAAGACGGCTGTGCCCAACGCCAACTCGCTCAGGGGCTTCGAGGTCATTGACGCCATCAAGGCCGAGCTGGAGCGGGAGTGCCCAGAGACAGTCTCCTGTG
CCGACCTCCTTGCCATCGCTGCCCGTGATTCCGTCGTCGTG
GTAAGGACGACGTAGCATACATATGCATTGATCGGTCATACTGTACATCTTTTCAAGTCGCATCTTTTTTCCTACTGTA
TATATATAGTGAGTGATCATCGTTTGTTGCATCATCATCATTAAATTGTCCGGCGGCCGGTGGATCAGTCGGGCGGGCCGAGCTGGGAGGTAGAGGTCGGCCGGAAGGACAGCCGCACCG
CCAGCCTGCAGGGTGCCAACACCAACCTACCAGCACCGACGTCTGGCGTCGCCACCCTCGTGCAGAAGTTCAGGAACGTCGGTCTTTCTGCCAAGGACATGGTCGCACTCTCCG
GTAAGT
ATATATTACACATCATATATACACGCTCTCTCTTCACGAATCTCTGCATACATGCATACTCGGCCGGCACACGTACATGTATACGTACGTGCAGACTAAATAAATACTAATTTACATTAA
TACTAATTCACATGAATGTATACACAGGCGCGCACACGATCGGGAAAGCGCGGTGCACTTCGTTCAGTGCGCGCCTTGCGGGCGTCGGCGGCGTCTCGGAAGGCGGCGTCGGCGCATTCA
AGGACCTAACCTTCCTGCAGTCGCTGCAGCAGCTGTGCACGGGGTCGGCTGGATCGGCGCTGGCGCACCTGGACCTCACCACCCCAGCGACCTTCGACAACCAGTACTACATCAACCTGC
TCTCCGGCGACGGCCTGCTGCCGTCAGACCAGGCACTAGCGTCGTCGTCGGGTGTCGCGCCGGGGGTTGAGGCGGACGTCGCCAGCCTCGTCGCCATCTATGCCTTCGACGCCTCTGTAT
TCTTCCAGGACTTCGCAGAGTCCATGCTGCGGATGGGGAGGCTTGCACCAGGCGCGGGCACCAGTGGCGAGGTCCGCCGGAACTGCCGGGTGGTGAACATCTCCGGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTCCACCACCTTGGCCCTGCACCTGCTGGTCGTCGTCGTGATGGCGCTCATCTTTGTTGCCTCGGCCAGTGTCTCCGCTCCCGTCAACAAGTCGTGCGTCACCGGTAGCGCC
GGCGCCAGTGTGAGCATTGGCTACGGCGGGGCAAGGGCCAGCGCCGGCGCTGGCGTGTCCCTTGGTGCCGACGCGTACAGGACCACCTGCCCCCGCGCCGAGGAGGTCGTCCGTGCGGCC
GTTGAGTGGGCCGTCGCTGCCGACCCACGCATGGCTGCGTCTCTCCTGCGCCTCCATTTCCACGACTGCTTCGTCAAC
GGTTGTGATGGCTCCGTTCTTCTGGACGACAAGCCGTTTCTC
GTTGGCGAGAAGACGGCTGTGCCCAACGCCAACTCGCTCAGGGGCTTCGAGGTCATTGACGCCATCAAGGCCGAGCTGGAGCGGGAGTGCCCAGAGACAGTCTCCTGTGCCGACCTCCTT
GCCATCGCTGCCCGTGATTCCGTCGTCGTG
TCGGGCGGGCCGAGCTGGGAGGTAGAGGTCGGCCGGAAGGACAGCCGCACCGCCAGCCTGCAGGGTGCCAACACCAACCTACCAGCACCG
ACGTCTGGCGTCGCCACCCTCGTGCAGAAGTTCAGGAACGTCGGTCTTTCTGCCAAGGACATGGTCGCACTCTCCG
GCGCGCACACGATCGGGAAAGCGCGGTGCACTTCGTTCAGTGCG
CGCCTTGCGGGCGTCGGCGGCGTCTCGGAAGGCGGCGTCGGCGCATTCAAGGACCTAACCTTCCTGCAGTCGCTGCAGCAGCTGTGCACGGGGTCGGCTGGATCGGCGCTGGCGCACCTG
GACCTCACCACCCCAGCGACCTTCGACAACCAGTACTACATCAACCTGCTCTCCGGCGACGGCCTGCTGCCGTCAGACCAGGCACTAGCGTCGTCGTCGGGTGTCGCGCCGGGGGTTGAG
GCGGACGTCGCCAGCCTCGTCGCCATCTATGCCTTCGACGCCTCTGTATTCTTCCAGGACTTCGCAGAGTCCATGCTGCGGATGGGGAGGCTTGCACCAGGCGCGGGCACCAGTGGCGAG
GTCCGCCGGAACTGCCGGGTGGTGAACATCTCCGGCTAG

Retrieve as FASTA