Entry information : SbPrx13 (Sobic.001G314100.1[2.1] / Sb01g030540[1.4])
Entry ID 2733
Creation 2008-10-13 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx13 (Sobic.001G314100.1[2.1] / Sb01g030540[1.4])
Name (synonym) SbPrx13 (Sobic.001G314100.1[2.1] / Sb01g030540[1.4])
Class Class III peroxidase    [Orthogroup: Prx189]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx13
start..stop
S start..stop
ZmPrx52 535 0 23..320 20..318
OsPrx127 421 3e-149 1..319 1..317
BdiPrx107 384 5e-135 19..319 16..318
ZmPrx05 279 2e-93 33..315 24..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53037708..53037941 234 N° 2 53037399..53037583 185 N° 3 53036742..53037285 544  
complement(join(53036742..53037285,53037399..53037583,53037708..53037941))


exon

Literature and cross-references SbPrx13 (Sobic.001G314100.1[2.1] / Sb01g030540[1.4])
DNA ref. Phytozome 12:   chromosome_1 (53037935..53036742)
Protein sequence: SbPrx13 (Sobic.001G314100.1[2.1] / Sb01g030540[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320
PWM (Da):   %s   34492.46  
PI (pH):   %s   9.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMGKQQGAGLLFLVVVAGLLLHDTRVADAQTLRVGYYNQTCRNAESIVADEVLKASYRDKGVLASLIRLHFHDCFVNGCDGSVLLESSDRQAEKNAKPNLSLRGFDVIERIKQRLEAACALTVSCADIVAFAARDSVKLGGVGYAVPGGRQDGTVSRASMTGDLPPPNQRSVDQLAQYFYRKGLTLDDMILLLGAHSLGVAHCGTFDYRLTSDQDKGMDAAFRNSLRSQCRHNASNAVPFDAGSPYAFDTGYFANVLANRTVLESDAALASPRAAGKVRQWKDNPGWFRSSFAAAMVKMGSIRGTNPGKVRLSCNRVRM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATGGGGAAGCAGCAGGGAGCAGGGCTGCTGTTCCTCGTCGTCGTTGCAGGCCTGCTCCTGCACGACACCCGTGTCGCCGATGCGCAGACTCTCCGGGTCGGCTACTACAACCAG
ACGTGCCGCAACGCCGAGTCCATCGTCGCCGACGAGGTCCTGAAGGCGTCCTACAGGGATAAGGGCGTCCTTGCCAGCCTCATCCGGCTCCACTTCCACGACTGCTTCGTCAAT
GTAAGA
TCGATCGAGACACTAGGCACCATGCAGTACCTGAGTATCTCGTCAACGCTCGCCGATTTGCTCACCGGAACCGGGACGGCGGCCGTGCATCGTCCGCTGTTTTTTCATTTCATTTCAGGG
CTGCGACGGGTCGGTGCTGCTGGAGTCTAGCGACCGGCAGGCGGAGAAGAACGCCAAGCCCAACCTGAGCCTGCGAGGGTTCGACGTCATCGAGCGGATCAAGCAGAGGTTGGAGGCCGC
GTGCGCACTGACGGTCTCCTGCGCCGACATCGTCGCCTTCGCCGCCAGGGACAGCGTTAAGCT
GGTACGTAGATTATTGCTTGCTTTTATTTCAATCTTACTACTGATAAGTGATAATCA
TCATCAAACTAAACGGGAATTAACTAACTAATGAAAACTCACGAGCATGCACAGAGCGGTGGTGTTGGGTACGCCGTCCCCGGCGGGCGGCAGGACGGCACGGTGTCGCGGGCGAGCATG
ACCGGCGACCTCCCGCCGCCGAACCAGCGGAGCGTGGACCAGCTCGCGCAGTACTTCTACCGCAAGGGCCTGACGCTGGACGACATGATCCTCCTCCTGGGCGCGCACTCGCTGGGCGTC
GCGCACTGCGGCACCTTCGACTACCGGCTGACGAGCGACCAGGACAAGGGCATGGACGCCGCGTTCCGGAACAGCCTGCGGAGCCAGTGCCGGCACAACGCCAGCAACGCCGTGCCCTTC
GACGCCGGCAGCCCGTACGCGTTCGACACAGGCTACTTCGCCAACGTGCTCGCCAACCGCACCGTGCTCGAGTCCGACGCCGCGCTCGCCTCGCCGCGCGCCGCGGGCAAGGTGAGGCAG
TGGAAGGACAACCCGGGCTGGTTCAGGAGCAGCTTCGCGGCCGCCATGGTCAAGATGGGCAGCATCCGCGGCACCAACCCAGGCAAGGTCCGCCTCAGCTGCAACAGGGTCAGGATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATGGGGAAGCAGCAGGGAGCAGGGCTGCTGTTCCTCGTCGTCGTTGCAGGCCTGCTCCTGCACGACACCCGTGTCGCCGATGCGCAGACTCTCCGGGTCGGCTACTACAACCAG
ACGTGCCGCAACGCCGAGTCCATCGTCGCCGACGAGGTCCTGAAGGCGTCCTACAGGGATAAGGGCGTCCTTGCCAGCCTCATCCGGCTCCACTTCCACGACTGCTTCGTCAAT
GGCTGC
GACGGGTCGGTGCTGCTGGAGTCTAGCGACCGGCAGGCGGAGAAGAACGCCAAGCCCAACCTGAGCCTGCGAGGGTTCGACGTCATCGAGCGGATCAAGCAGAGGTTGGAGGCCGCGTGC
GCACTGACGGTCTCCTGCGCCGACATCGTCGCCTTCGCCGCCAGGGACAGCGTTAAGCT
CGGTGGTGTTGGGTACGCCGTCCCCGGCGGGCGGCAGGACGGCACGGTGTCGCGGGCGAGC
ATGACCGGCGACCTCCCGCCGCCGAACCAGCGGAGCGTGGACCAGCTCGCGCAGTACTTCTACCGCAAGGGCCTGACGCTGGACGACATGATCCTCCTCCTGGGCGCGCACTCGCTGGGC
GTCGCGCACTGCGGCACCTTCGACTACCGGCTGACGAGCGACCAGGACAAGGGCATGGACGCCGCGTTCCGGAACAGCCTGCGGAGCCAGTGCCGGCACAACGCCAGCAACGCCGTGCCC
TTCGACGCCGGCAGCCCGTACGCGTTCGACACAGGCTACTTCGCCAACGTGCTCGCCAACCGCACCGTGCTCGAGTCCGACGCCGCGCTCGCCTCGCCGCGCGCCGCGGGCAAGGTGAGG
CAGTGGAAGGACAACCCGGGCTGGTTCAGGAGCAGCTTCGCGGCCGCCATGGTCAAGATGGGCAGCATCCGCGGCACCAACCCAGGCAAGGTCCGCCTCAGCTGCAACAGGGTCAGGATG
TGA

Retrieve as FASTA