Entry information : SbPrx137 (Sobic.010G161900.1 [2.1] / SB10G021640 [1.4])
Entry ID 2734
Creation 2006-01-13 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx137 (Sobic.010G161900.1 [2.1] / SB10G021640 [1.4])
Name (synonym) SbPrx137 (Sobic.010G161900.1 [2.1] / SB10G021640 [1.4])
Class Class III peroxidase    [Orthogroup: Prx149]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx137
start..stop
S start..stop
BdiPrx24 557 0 14..318 14..318
OsPrx87 532 0 26..318 34..327
ZmPrx76 527 0 1..318 1..318
OsPrx88 478 6e-172 24..318 24..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 47780368..47780580 213 N° 2 47780058..47780249 192 N° 3 47779405..47779956 552  
complement(join(47779405..47779956,47780058..47780249,47780368..47780580))


exon

Literature and cross-references SbPrx137 (Sobic.010G161900.1 [2.1] / SB10G021640 [1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_10 (47780580..47779405)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.48332.1
Protein sequence: SbPrx137 (Sobic.010G161900.1 [2.1] / SB10G021640 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   33155.72 (30701.4)  
PI (pH):   %s   8.85 (8.92) Peptide Signal:   %s   cut: 28 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTSSLARSVALLTLLCLLLTCHGKLSTKFYAKSCPGVAAIVRSVTAQAVAKEPRMGASIIRLFFHDCFVNGCDASILLDDTPTFTGEKNAGANVNSVRGYEVIDAIKTQVEAACKATVSCADIVALASRDAVNLLGGPTWNVQLGRTDSRTASQSAANANLPGPGSSAASLVAAFAAKGLSARDMTALSGAHTVGRARCVFFRGRIYGEPNINATFAAVRQQTCPQTGGDGNLAPFDDQTPDAFDNAYYANLVARRGLLHSDQELFNGGTQDALVRKYSGNGRMFANDFAKAMVKMGGLAPAAGTPTEVRLNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCACGTCGTCGTTGGCGAGAAGCGTTGCTCTTCTTACTCTGCTCTGCCTGCTTCTTACCTGTCATGGGAAGCTCTCCACCAAGTTCTACGCCAAGTCGTGCCCGGGCGTGGCCGCC
ATCGTCCGGTCGGTGACGGCGCAGGCAGTCGCCAAGGAGCCCAGGATGGGCGCGTCCATCATCCGCCTCTTCTTCCACGACTGCTTCGTCAAT
GTCGGTCACCATTTAGTATTATCCTAA
TAATGTTCATCATGTTAGCCTAGGTTGCCGCTACTCATCAGACATCAGTGTGCAGTGCACTGAGCCACTGACATATGTGTGTGCGACACAGGGTTGTGACGCGTCCATCCTCCTGGATGA
CACGCCGACGTTCACCGGCGAGAAGAACGCCGGAGCCAACGTCAACTCCGTCCGCGGGTACGAGGTCATCGACGCCATCAAGACGCAGGTCGAAGCAGCCTGCAAGGCCACCGTCTCGTG
CGCCGACATCGTCGCCTTGGCGTCTCGTGACGCCGTAAACTTG
GTCAGTTCGTCTATTGCTAAGAGAGAATCCAATGTCCAGCAAGCACTTCGCCGCTTCCAAATGACGACGGACGCTGA
TCTGCATGCAATGCAACGACGCAGCTCGGAGGCCCAACATGGAACGTGCAGCTCGGCCGGACGGACTCGCGCACGGCGAGCCAGAGCGCGGCCAACGCCAACCTCCCAGGCCCGGGCTCC
AGCGCGGCGTCCCTCGTCGCCGCGTTCGCGGCCAAGGGGCTCTCGGCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCGTGGGGCGGGCGCGGTGCGTCTTCTTCCGCGGGCGCATC
TACGGCGAGCCCAACATCAACGCCACCTTCGCGGCGGTGCGGCAGCAGACGTGCCCGCAGACCGGCGGCGACGGCAACCTCGCGCCGTTCGACGACCAGACGCCCGACGCGTTCGACAAC
GCCTACTACGCGAACCTGGTGGCGCGGCGCGGGCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGGACACAGGACGCGCTGGTGAGGAAGTACAGCGGCAATGGCCGCATGTTCGCC
AACGACTTCGCGAAGGCGATGGTCAAGATGGGCGGCCTTGCGCCGGCGGCCGGAACGCCCACGGAGGTCAGATTGAACTGCCGGAAGGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCACGTCGTCGTTGGCGAGAAGCGTTGCTCTTCTTACTCTGCTCTGCCTGCTTCTTACCTGTCATGGGAAGCTCTCCACCAAGTTCTACGCCAAGTCGTGCCCGGGCGTGGCCGCC
ATCGTCCGGTCGGTGACGGCGCAGGCAGTCGCCAAGGAGCCCAGGATGGGCGCGTCCATCATCCGCCTCTTCTTCCACGACTGCTTCGTCAAT
GGTTGTGACGCGTCCATCCTCCTGGAT
GACACGCCGACGTTCACCGGCGAGAAGAACGCCGGAGCCAACGTCAACTCCGTCCGCGGGTACGAGGTCATCGACGCCATCAAGACGCAGGTCGAAGCAGCCTGCAAGGCCACCGTCTCG
TGCGCCGACATCGTCGCCTTGGCGTCTCGTGACGCCGTAAACTTG
CTCGGAGGCCCAACATGGAACGTGCAGCTCGGCCGGACGGACTCGCGCACGGCGAGCCAGAGCGCGGCCAACGCC
AACCTCCCAGGCCCGGGCTCCAGCGCGGCGTCCCTCGTCGCCGCGTTCGCGGCCAAGGGGCTCTCGGCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCGTGGGGCGGGCGCGGTGC
GTCTTCTTCCGCGGGCGCATCTACGGCGAGCCCAACATCAACGCCACCTTCGCGGCGGTGCGGCAGCAGACGTGCCCGCAGACCGGCGGCGACGGCAACCTCGCGCCGTTCGACGACCAG
ACGCCCGACGCGTTCGACAACGCCTACTACGCGAACCTGGTGGCGCGGCGCGGGCTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGGACACAGGACGCGCTGGTGAGGAAGTACAGC
GGCAATGGCCGCATGTTCGCCAACGACTTCGCGAAGGCGATGGTCAAGATGGGCGGCCTTGCGCCGGCGGCCGGAACGCCCACGGAGGTCAGATTGAACTGCCGGAAGGTGAACTAA

Retrieve as FASTA