Entry information : SbPrx117 (Sobic.009G086100.1 [2.1] / Sb09g007950 [1.4])
Entry ID 2739
Creation 2008-10-28 (Christophe Dunand)
Last sequence changes 2008-10-28 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx117 (Sobic.009G086100.1 [2.1] / Sb09g007950 [1.4])
Name (synonym) SbPrx117 (Sobic.009G086100.1 [2.1] / Sb09g007950 [1.4])
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx117
start..stop
S start..stop
ZmPrx33 562 0 5..338 4..338
OsPrx73 357 3e-124 43..338 10..308
AtrPrx19 301 4e-102 41..337 6..303
MguPrx19 295 3e-99 32..333 20..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14641638..14641901 264 N° 2 14641181..14641544 364 N° 3 14640621..14641006 386  
complement(join(14640621..14641006,14641181..14641544,14641638..14641901))


exon

Literature and cross-references SbPrx117 (Sobic.009G086100.1 [2.1] / Sb09g007950 [1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_9 (14641901..14640621)
Protein sequence: SbPrx117 (Sobic.009G086100.1 [2.1] / Sb09g007950 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (304)
PWM (Da):   %s   35716.17 (32229.2)  
PI (pH):   %s   6.26 (5.87) Peptide Signal:   %s   cut: 35 range:35-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVLSRGEKLGTIVCVLAHVSLLVLVLAPCVCKATGDNYGGGLSDDHYRESCPELEIITKKSLAPIFAVDITSPAALLRLLFHDCQVHGCDGSILLSSDERRHTTSELDSRKNHGIRHVGTIGLVKAAVEAACPGLVSCADIVVLAAREAVAHAGGPRIASVPLGRRDATTTSTQAADAQLPSCFLGIDGALDIFTSHGMTVEETVAILGSHTLGGGHCISIDSGREWRDKAFQALVYLQCPKIVPPLITEAVVVSSDLTPTWFDTHYYWGAAAGRGLFNVDAEASTDARTAAYVRKFAHDREGFFGVFASAFVKLAGFGVLTGEEGEIRKECHVVN

Retrieve as FASTA  
Remarks Comlete sequence from genomic (chromo 9, introns 1 and 3). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTGTTGTCTCGTGGTGAGAAGCTTGGTACTATTGTTTGTGTTCTGGCACATGTATCGTTATTGGTGCTCGTGCTAGCTCCCTGTGTGTGCAAGGCGACTGGTGACAACTACGGC
GGCGGCCTCTCCGACGACCACTACAGGGAGTCCTGCCCGGAGCTGGAGATCATCACCAAGAAGTCCCTGGCGCCGATCTTCGCCGTGGACATCACCTCGCCGGCCGCCCTCCTCCGCCTG
CTCTTCCACGACTGCCAAGTCCAT
GTACGCACGTACGAGAAGAGATCGATCCGCTCCTTTGTTGGATGATGACTGAGATGGTAACGATCGTTGGTGTGTGCGCGCGCGCGGCTGCAGGGA
TGTGACGGCTCCATATTGCTCAGCTCCGACGAGCGCCGGCACACGACCTCGGAGCTGGACTCACGCAAGAACCACGGCATCCGGCACGTCGGCACGATCGGGCTCGTGAAGGCGGCCGTG
GAAGCGGCCTGCCCCGGCCTGGTGTCCTGCGCCGACATCGTCGTCCTGGCGGCGAGGGAGGCCGTGGCGCACGCCGGCGGGCCGCGCATCGCCAGCGTGCCCCTTGGCCGGAGGGACGCC
ACCACTACCAGCACGCAGGCCGCCGATGCGCAGCTTCCGTCCTGTTTCCTCGGGATTGACGGCGCGCTCGACATCTTTACCAGCCACGGCATGACCGTCGAGGAGACAGTCGCCATTCTA
G
GTTTATTTTCCAACAATGCAAAAAGTTGCTCGTGCTGGTTGAGCCGCTGGTTTAAAAAGTTATGGCTAAAAGAACTGCTCGCTAATTCGAAGCTAGTTATATATTGATGCAAAATTAAG
CTCGAACATTTTCTTAATGTGTGTGATCTTTCTTCATATATATACATTCATGCAGGAAGCCACACGCTGGGGGGTGGCCACTGCATCAGCATAGACAGCGGCCGCGAGTGGCGTGACAAG
GCTTTCCAGGCCCTGGTGTATCTGCAGTGCCCCAAGATCGTGCCGCCACTGATCACAGAGGCCGTCGTTGTGTCCAGCGACCTGACGCCGACATGGTTCGACACCCACTACTACTGGGGC
GCCGCCGCAGGCCGTGGGCTCTTCAACGTCGACGCCGAGGCTTCCACCGACGCGCGCACGGCGGCCTACGTGAGGAAGTTTGCTCACGACAGGGAGGGCTTCTTCGGGGTCTTTGCCTCG
GCGTTCGTGAAGCTCGCTGGGTTTGGCGTGCTCACCGGTGAGGAGGGTGAGATCAGGAAGGAGTGTCATGTCGTCAACTAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTGTTGTCTCGTGGTGAGAAGCTTGGTACTATTGTTTGTGTTCTGGCACATGTATCGTTATTGGTGCTCGTGCTAGCTCCCTGTGTGTGCAAGGCGACTGGTGACAACTACGGC
GGCGGCCTCTCCGACGACCACTACAGGGAGTCCTGCCCGGAGCTGGAGATCATCACCAAGAAGTCCCTGGCGCCGATCTTCGCCGTGGACATCACCTCGCCGGCCGCCCTCCTCCGCCTG
CTCTTCCACGACTGCCAAGTCCAT
GGATGTGACGGCTCCATATTGCTCAGCTCCGACGAGCGCCGGCACACGACCTCGGAGCTGGACTCACGCAAGAACCACGGCATCCGGCACGTCGGC
ACGATCGGGCTCGTGAAGGCGGCCGTGGAAGCGGCCTGCCCCGGCCTGGTGTCCTGCGCCGACATCGTCGTCCTGGCGGCGAGGGAGGCCGTGGCGCACGCCGGCGGGCCGCGCATCGCC
AGCGTGCCCCTTGGCCGGAGGGACGCCACCACTACCAGCACGCAGGCCGCCGATGCGCAGCTTCCGTCCTGTTTCCTCGGGATTGACGGCGCGCTCGACATCTTTACCAGCCACGGCATG
ACCGTCGAGGAGACAGTCGCCATTCTAG
GAAGCCACACGCTGGGGGGTGGCCACTGCATCAGCATAGACAGCGGCCGCGAGTGGCGTGACAAGGCTTTCCAGGCCCTGGTGTATCTGCAG
TGCCCCAAGATCGTGCCGCCACTGATCACAGAGGCCGTCGTTGTGTCCAGCGACCTGACGCCGACATGGTTCGACACCCACTACTACTGGGGCGCCGCCGCAGGCCGTGGGCTCTTCAAC
GTCGACGCCGAGGCTTCCACCGACGCGCGCACGGCGGCCTACGTGAGGAAGTTTGCTCACGACAGGGAGGGCTTCTTCGGGGTCTTTGCCTCGGCGTTCGTGAAGCTCGCTGGGTTTGGC
GTGCTCACCGGTGAGGAGGGTGAGATCAGGAAGGAGTGTCATGTCGTCAACTAC

Retrieve as FASTA