Entry information : LuPrx02 (FLXPER2|Lus10009932|PACid:23150136)
Entry ID 274
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-18 (Christophe Dunand)
Peroxidase information: LuPrx02 (FLXPER2|Lus10009932|PACid:23150136)
Name (synonym) LuPrx02 (FLXPER2|Lus10009932|PACid:23150136)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx02
start..stop
S start..stop
LuPrx171 615 0 2..325 3..327
LuPrx61 520 0 2..325 1..328
MePrx83 481 3e-173 10..325 1..316
LuPrx170 472 7e-170 43..325 1..283
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 185350..185574 225 N° 2 184750..184941 192 N° 3 184476..184644 169 N° 4 183759..184150 392
complement(join(183759..184150,184476..184644,184750..184941,185350..185574))


exon

Literature and cross-references LuPrx02 (FLXPER2|Lus10009932|PACid:23150136)
Literature REFERENCE 1
Omann,F., Beaulieu,N. and Tyson,H. cDNA sequence and tissue-specific expression of an anionic flax peroxidase Genome 37 (1), 137-147 (1994)
REFERENCE 2
Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
Protein ref. UniProtKB:   Q42904
DNA ref. Phytozome 12:   scaffold200 (185574..183759)
mRNA ref. GenBank:   L24120
Protein sequence: LuPrx02 (FLXPER2|Lus10009932|PACid:23150136)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (297)
PWM (Da):   %s   34632.85 (31759.4)  
PI (pH):   %s   4.7 (4.55) Peptide Signal:   %s   cut: 29 range:29-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAGNSNIWLRSCLVLLVAVCGAGKCWGQLSTDFYSESCPMLMDTVRCEVESAVDKETRIAASLLRLHFHDCFVNGCDGSILLEDTDSFTGEQTAAPNNGSVRGYNVIEDIKSKVEQVCPGVVSCADIVAIAARDSTVIAGGQSWEVKVGRRDSKTASFNAANSGVLPAPTSSLNELIKSFGDQGLSANDMVVLSGSHTIGVARCVSFRDRIYNETNIDPSFASQRQENCPLAPNSGDDNLAPLDLKTPTSFDNNYYNNLIEQKGLLHSDQVLFNGGSTDSLVRSYSQSPKAFAADFAAAMVKMGDIKPLTGSQGEIRNVCSRPN

Retrieve as FASTA  
Remarks Complete sequence from genomic and mRNA. mRNA expression is unique to stem tissue. Sub_species="Stormont cirrus". Experimental evidency of cell wall localization
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCGGTAACTCAAATATTTGGCTGCGTTCATGTTTGGTGCTTTTGGTTGCGGTGTGTGGTGCTGGGAAATGTTGGGGTCAGCTCTCCACAGACTTCTATTCAGAGAGCTGCCCT
ATGCTGATGGACACGGTGAGGTGTGAAGTTGAATCCGCCGTTGACAAGGAAACAAGGATTGCTGCTTCTCTCCTTCGCTTGCACTTCCACGACTGTTTCGTCAAC
GTAATTATCGATCTC
TTTCACATCTCTCTCTCCACAATTTTCTATTGAAAATCAGTTATCATAACCTAGAGTTAAAGATTATTAAAAAAAAACTAGTGAGAAAAGATAATTTGTTTTGTAATATAGTAGCAGTGC
AAAGTAGGCACTAACTAGTCAAAGCCACTATTTTCATAAAAAAACAAAACATGGGGTGAGAGAGGCTCGAACTCTCGACCTCAGGATCACTCTCAGCTATGAGACCTACGCGCTAACCAA
CTGCGCCACCACCCCTCGTTGCGAAATTCATAACAGTTATAAACCTCACCTACAGAGCTCCACACCTGTATATGAATTATGATTAGAATTTTCGACTAACCACATAATAATTATCTGCAA
CTTTTATTTGTGGACTGGTGACTGATCAAACAGGGTTGTGATGGGTCGATACTGCTGGAAGACACGGATTCGTTCACAGGAGAACAGACTGCTGCACCAAACAACGGATCCGTGAGAGGA
TATAACGTCATTGAAGACATTAAGTCAAAAGTTGAGCAAGTATGTCCTGGAGTAGTCTCCTGCGCAGACATCGTCGCCATCGCTGCTCGAGATTCCACCGTCATC
GTAAGTAACCAACCA
ATATACGCATGTTGTTCATATACATGGTACTTGGGCTTTGATGTTGTTGGTTATGAATTGATGCAATAACGGGGGCCGGGTGTACTGCAGGCAGGAGGGCAGAGCTGGGAAGTGAAAGTT
GGAAGGAGGGATTCAAAGACAGCCAGTTTTAATGCAGCAAATAGTGGAGTGCTCCCTGCGCCTACATCTTCACTTAACGAGCTCATTAAGAGCTTCGGGGACCAAGGCCTCTCTGCTAAC
GACATGGTCGTTCTATCCG
GTACGTACGCTTTCAATCTTCCAGTTCATTTCACAGTTTAGTACAATATAGTTTATTATCATGCATTGCAAGGTTTAGATTACTCTCTTAATTTTAAATTT
TCATATATTATATTTTACTTCTCTCTGTTGAATTTGTTGACTCAAACTTAATTAAGAAAAATAATACACTTAAATTTCCTAACTTCTACCAACAAACCAATATCATCATTAATGACTTGA
TAATTACTTCATTTTCCATTATTCCTTTTCTGTGTATGTACACAGGGAAGTGGTAAATAATAATTAATTCATATCTCTATGCCCCTGAATGATGATGAATATAGGATCCCACACCATCGG
AGTAGCGAGGTGCGTTTCGTTTAGGGACCGAATCTACAACGAGACCAACATCGACCCTTCATTCGCAAGCCAAAGGCAAGAGAATTGCCCCTTAGCACCAAACTCAGGCGACGACAACCT
GGCCCCACTGGACCTCAAAACGCCGACATCATTCGACAACAACTACTACAACAACCTCATCGAGCAAAAAGGTCTTCTCCACTCCGACCAAGTCCTGTTCAACGGCGGATCAACCGATTC
TCTAGTACGATCCTATAGCCAGAGCCCGAAGGCATTCGCTGCAGACTTTGCCGCAGCCATGGTTAAGATGGGAGACATCAAGCCCCTCACTGGGTCTCAGGGAGAGATCAGGAACGTATG
TAGCAGACCTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCGGTAACTCAAATATTTGGCTGCGTTCATGTTTGGTGCTTTTGGTTGCGGTGTGTGGTGCTGGGAAATGTTGGGGTCAGCTCTCCACAGACTTCTATTCAGAGAGCTGCCCT
ATGCTGATGGACACGGTGAGGTGTGAAGTTGAATCCGCCGTTGACAAGGAAACAAGGATTGCTGCTTCTCTCCTTCGCTTGCACTTCCACGACTGTTTCGTCAAC
GGTTGTGATGGGTCG
ATACTGCTGGAAGACACGGATTCGTTCACAGGAGAACAGACTGCTGCACCAAACAACGGATCCGTGAGAGGATATAACGTCATTGAAGACATTAAGTCAAAAGTTGAGCAAGTATGTCCT
GGAGTAGTCTCCTGCGCAGACATCGTCGCCATCGCTGCTCGAGATTCCACCGTCATC
GCAGGAGGGCAGAGCTGGGAAGTGAAAGTTGGAAGGAGGGATTCAAAGACAGCCAGTTTTAAT
GCAGCAAATAGTGGAGTGCTCCCTGCGCCTACATCTTCACTTAACGAGCTCATTAAGAGCTTCGGGGACCAAGGCCTCTCTGCTAACGACATGGTCGTTCTATCCG
GATCCCACACCATC
GGAGTAGCGAGGTGCGTTTCGTTTAGGGACCGAATCTACAACGAGACCAACATCGACCCTTCATTCGCAAGCCAAAGGCAAGAGAATTGCCCCTTAGCACCAAACTCAGGCGACGACAAC
CTGGCCCCACTGGACCTCAAAACGCCGACATCATTCGACAACAACTACTACAACAACCTCATCGAGCAAAAAGGTCTTCTCCACTCCGACCAAGTCCTGTTCAACGGCGGATCAACCGAT
TCTCTAGTACGATCCTATAGCCAGAGCCCGAAGGCATTCGCTGCAGACTTTGCCGCAGCCATGGTTAAGATGGGAGACATCAAGCCCCTCACTGGGTCTCAGGGAGAGATCAGGAACGTA
TGTAGCAGACCTAACTAA

Retrieve as FASTA