Entry information : SbPrx77 (Sobic.004G106100.1 [2.1] / SB04G008650 [1.4])
Entry ID 2741
Creation 2006-01-16 (Christophe Dunand)
Last sequence changes 2006-01-16 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx77 (Sobic.004G106100.1 [2.1] / SB04G008650 [1.4])
Name (synonym) SbPrx77 (Sobic.004G106100.1 [2.1] / SB04G008650 [1.4])
Class Class III peroxidase    [Orthogroup: Prx220]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx77
start..stop
S start..stop
ZmPrx116 500 2e-180 3..323 2..322
SiPrx80 491 4e-177 3..323 2..320
SiPrx82 439 3e-156 1..323 1..321
SiPrx77 438 4e-156 1..323 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10104536..10104751 216 N° 2 10104828..10105022 195 N° 3 10105156..10105716 561  
join(10104536..10104751,10104828..10105022,10105156..10105716)


exon

Literature and cross-references SbPrx77 (Sobic.004G106100.1 [2.1] / SB04G008650 [1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_4 (10104536..10105716)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.7699.1
Protein sequence: SbPrx77 (Sobic.004G106100.1 [2.1] / SB04G008650 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (299)
PWM (Da):   %s   33637.45 (31176.3)  
PI (pH):   %s   6.64 (6.49) Peptide Signal:   %s   cut: 25 range:25-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTTTGHCMFFALILLSSAAYGQLSTSFYDTSCPSLESTVRSVVSGVINNGNRRMGASLLRLFFHDCFVQGCDASILLDDVPGTFVGEKNAGPNANSVLGYDVINNIKTAVEANCPGVVSCADIVALAARDGVNLLGGPTWSVSLGRRDSTTASQSQANSDLPSPASSLSTLIAAFASKGLNATDMTALSGAHTVGMAQCKTYRSRIYSDANINKQFANTLKGNCSATQGGSTDTNLAGLDVQTQVVFDNAYFGNLMKKKGLLHSDQELFNGGSQDALVQQYDADPGLFASHFVTAMIKMGNISPLTGSQGQIRANCGRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCACGACGACCGGCCATTGCATGTTCTTTGCACTGATTCTCCTCTCTTCGGCGGCGTACGGCCAGCTCTCGACGTCGTTCTACGACACCAGCTGCCCGTCGCTGGAGTCC
ACAGTGCGCTCCGTCGTGTCTGGTGTCATCAATAACGGCAACCGCCGGATGGGCGCCTCCCTTCTCCGCCTCTTCTTCCACGACTGCTTCGTTCAG
GTATTGCATGCTGCTTTGCTGAAT
CGATCCCATTCCCATTGCATCTGCTGTCCTCTGATCTCCCATGCATCATCAGGGCTGCGACGCCTCGATTCTTCTTGACGACGTGCCGGGCACCTTCGTCGGCGAGAAAAACGCCGGCCC
CAACGCCAACTCCGTCCTCGGCTACGACGTCATCAACAACATAAAGACGGCCGTCGAGGCCAACTGCCCCGGCGTCGTCTCCTGCGCCGACATCGTCGCCCTCGCCGCGCGGGACGGCGT
CAACCTG
GTCAGTCGTCGTCGTCAGCGACCCAATAATGCAACGACAACCTGCGCCGCCTGTTGGCTGCAGCAGCTAGCTGTTTTTGTTTGCCTGCATCGATCAATCATCATGACAGATCG
GCTGTTGATTTTGCATGCAGCTCGGCGGACCGACCTGGAGCGTGTCTCTGGGCCGGCGGGACTCGACGACGGCGAGCCAGAGCCAAGCGAACAGCGACCTGCCGTCGCCGGCGTCTAGCC
TGAGCACGCTCATCGCGGCGTTCGCGAGCAAGGGCCTGAACGCGACGGACATGACGGCGCTCTCCGGCGCGCACACCGTCGGCATGGCGCAGTGCAAGACGTACCGCAGCCGCATCTACA
GCGACGCCAACATCAACAAGCAGTTCGCCAACACGCTCAAGGGCAACTGCTCGGCGACGCAGGGCGGGAGTACCGACACCAACCTAGCGGGGCTGGACGTGCAGACGCAGGTCGTCTTCG
ACAACGCCTACTTTGGGAACCTGATGAAGAAGAAGGGACTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTGCAGCAGTACGACGCCGACCCGGGGCTCT
TCGCCTCACACTTCGTCACCGCTATGATAAAGATGGGGAACATCAGCCCGCTCACCGGAAGCCAAGGACAGATCAGGGCCAACTGCGGCAGGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCACGACGACCGGCCATTGCATGTTCTTTGCACTGATTCTCCTCTCTTCGGCGGCGTACGGCCAGCTCTCGACGTCGTTCTACGACACCAGCTGCCCGTCGCTGGAGTCC
ACAGTGCGCTCCGTCGTGTCTGGTGTCATCAATAACGGCAACCGCCGGATGGGCGCCTCCCTTCTCCGCCTCTTCTTCCACGACTGCTTCGTTCAG
GGCTGCGACGCCTCGATTCTTCTT
GACGACGTGCCGGGCACCTTCGTCGGCGAGAAAAACGCCGGCCCCAACGCCAACTCCGTCCTCGGCTACGACGTCATCAACAACATAAAGACGGCCGTCGAGGCCAACTGCCCCGGCGTC
GTCTCCTGCGCCGACATCGTCGCCCTCGCCGCGCGGGACGGCGTCAACCTG
CTCGGCGGACCGACCTGGAGCGTGTCTCTGGGCCGGCGGGACTCGACGACGGCGAGCCAGAGCCAAGCG
AACAGCGACCTGCCGTCGCCGGCGTCTAGCCTGAGCACGCTCATCGCGGCGTTCGCGAGCAAGGGCCTGAACGCGACGGACATGACGGCGCTCTCCGGCGCGCACACCGTCGGCATGGCG
CAGTGCAAGACGTACCGCAGCCGCATCTACAGCGACGCCAACATCAACAAGCAGTTCGCCAACACGCTCAAGGGCAACTGCTCGGCGACGCAGGGCGGGAGTACCGACACCAACCTAGCG
GGGCTGGACGTGCAGACGCAGGTCGTCTTCGACAACGCCTACTTTGGGAACCTGATGAAGAAGAAGGGACTGCTGCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTG
GTGCAGCAGTACGACGCCGACCCGGGGCTCTTCGCCTCACACTTCGTCACCGCTATGATAAAGATGGGGAACATCAGCCCGCTCACCGGAAGCCAAGGACAGATCAGGGCCAACTGCGGC
AGGGTTAATTAA

Retrieve as FASTA