Entry information : SbPrx33 (Sobic.002G307900.1 [2.1] / Sb02g033790 [1.4])
Entry ID 2746
Creation 2008-10-15 (Christophe Dunand)
Last sequence changes 2008-10-15 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx33 (Sobic.002G307900.1 [2.1] / Sb02g033790 [1.4])
Name (synonym) SbPrx33 (Sobic.002G307900.1 [2.1] / Sb02g033790 [1.4])
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducers Brassinolide treatment
Gibberellic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx33
start..stop
S start..stop
ZmPrx73 533 0 1..361 1..364
SiPrx118 478 8e-171 1..361 1..357
OsPrx102 380 3e-132 43..360 32..345
BdiPrx17 370 3e-128 1..361 3..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68327492..68327809 318 N° 2 68326999..68327356 358 N° 3 68326449..68326858 410  
complement(join(68326449..68326858,68326999..68327356,68327492..68327809))


exon

Literature and cross-references SbPrx33 (Sobic.002G307900.1 [2.1] / Sb02g033790 [1.4])
Literature Cordonnier-Pratt,M.-M., Suzuki,Y., Sugano,S., Klein,R., Brady,J., Liang,C., Sun,F. and Pratt,L.H. A Sorghum EST database: seedlings treated with gibberellic acid or brassinolide. Unpublished (2005)
DNA ref. Phytozome 12:   chromosome_2 (68327809..68326449)
EST ref. GenBank:   CX613148
Protein sequence: SbPrx33 (Sobic.002G307900.1 [2.1] / Sb02g033790 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (336)
PWM (Da):   %s   38630.62 (36090.2) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.78 (8.44) Peptide Signal:   %s   cut: 26 range:26-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTPRAVSSFLSLSGLLLLAVSVAAGSKGYGGDGAAAGSNGSGGQEGSYKVPAYQKPVAGLDERYYEKSCPQMEEIVGRAVMKAVKADETLAASIIRLFFHDFAVGGVDGSILLDVPGHSEKYAQASRTLRGFELIEEIKKELEAKCHATVSCADILTAAARDAVASPAVRGPYWTLNYGRKDRKGYFSANTADRDVPMGGQSVTQLISFFEKNGLNIQDLVALSGAHTIGRATCGAVRPGLCKRRKEGGALLLLDRQYGDFLQRKCRAGGDGEYVELDGETPTAFDNQYYKNLVHGKGLLDTDQKLLADSRTGGFVRSYANQRSQAFVGQFAQSMRRLGEAQVLTGNEGEVRRKCSAVNY

Retrieve as FASTA  
Remarks Complete sequence from Genomic (chromo 2, intron 1 and 3) and 1 EST. Missing 'c'. containing motif fhdf.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACGCCGCGGGCTGTCTCCTCGTTCTTGTCCCTTTCCGGGCTCCTCCTCCTCGCCGTCTCGGTGGCCGCGGGCTCCAAAGGTTACGGCGGCGATGGCGCTGCGGCCGGTTCGAAT
GGCAGCGGCGGCCAGGAAGGCAGCTACAAGGTGCCGGCGTACCAGAAGCCCGTGGCCGGCCTCGACGAGAGGTACTACGAGAAGTCGTGCCCGCAAATGGAGGAAATCGTCGGGAGGGCC
GTGATGAAGGCTGTGAAAGCCGACGAGACCCTCGCCGCCAGCATCATCCGCCTCTTCTTCCACGACTTCGCCGTCGGG
GTACGTATCGTCTTTCGTGCGTCATCAGCTTAACTAATTAAG
CTAGTTTATTTGTCACCGGTGAATCGAATTGACGACATGGTGAACGTGAAACGACTGATGTGGTCGTCGCCGGCGGGCGGTACGTACGTGCAGGGCGTGGACGGGTCGATCCTGTTAGAC
GTGCCGGGGCACAGCGAGAAGTACGCGCAGGCGAGCAGGACGCTGCGCGGGTTCGAGCTGATCGAGGAGATCAAGAAGGAGCTGGAGGCCAAGTGCCACGCCACCGTCTCCTGCGCCGAC
ATCCTCACCGCGGCCGCCCGCGACGCCGTCGCCTCGCCGGCGGTCAGGGGCCCCTACTGGACGCTCAACTACGGGCGCAAGGACCGGAAGGGCTACTTCAGCGCCAACACGGCCGACCGC
GACGTCCCCATGGGCGGCCAGAGCGTCACCCAGCTCATCTCCTTCTTCGAGAAGAACGGGCTCAACATCCAAGACCTCGTCGCCCTCTCCG
GTGAGCTCTCTCATCTGTCGATTAATTTG
GTTATCAATTGGGCACCGCCGCACGTACGCATCGATCGACGATCGACCGGCACATAACTAACTAACTAACACACACACATTATGCTGACATGACATTGACATGCATGGCAGGAGCTCACA
CGATCGGGCGCGCGACGTGCGGCGCGGTGAGGCCGGGGCTGTGCAAGCGCCGGAAGGAAGGAGGCGCGCTGCTGCTGCTGGACCGGCAGTACGGCGACTTCCTGCAGCGCAAGTGCCGCG
CGGGCGGCGACGGGGAGTACGTGGAGCTGGACGGCGAGACGCCCACGGCGTTCGACAACCAGTACTACAAGAACCTGGTGCACGGGAAGGGGCTGCTGGACACGGACCAGAAGCTGCTGG
CGGACTCCCGGACGGGCGGCTTCGTCAGGTCCTACGCCAACCAGAGGTCCCAGGCCTTCGTCGGCCAGTTCGCCCAATCCATGCGACGCCTCGGCGAGGCTCAGGTGCTCACCGGGAACG
AGGGCGAGGTCCGCCGCAAGTGCTCCGCCGTCAACTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACGCCGCGGGCTGTCTCCTCGTTCTTGTCCCTTTCCGGGCTCCTCCTCCTCGCCGTCTCGGTGGCCGCGGGCTCCAAAGGTTACGGCGGCGATGGCGCTGCGGCCGGTTCGAAT
GGCAGCGGCGGCCAGGAAGGCAGCTACAAGGTGCCGGCGTACCAGAAGCCCGTGGCCGGCCTCGACGAGAGGTACTACGAGAAGTCGTGCCCGCAAATGGAGGAAATCGTCGGGAGGGCC
GTGATGAAGGCTGTGAAAGCCGACGAGACCCTCGCCGCCAGCATCATCCGCCTCTTCTTCCACGACTTCGCCGTCGGG
GGCGTGGACGGGTCGATCCTGTTAGACGTGCCGGGGCACAGC
GAGAAGTACGCGCAGGCGAGCAGGACGCTGCGCGGGTTCGAGCTGATCGAGGAGATCAAGAAGGAGCTGGAGGCCAAGTGCCACGCCACCGTCTCCTGCGCCGACATCCTCACCGCGGCC
GCCCGCGACGCCGTCGCCTCGCCGGCGGTCAGGGGCCCCTACTGGACGCTCAACTACGGGCGCAAGGACCGGAAGGGCTACTTCAGCGCCAACACGGCCGACCGCGACGTCCCCATGGGC
GGCCAGAGCGTCACCCAGCTCATCTCCTTCTTCGAGAAGAACGGGCTCAACATCCAAGACCTCGTCGCCCTCTCCG
GAGCTCACACGATCGGGCGCGCGACGTGCGGCGCGGTGAGGCCG
GGGCTGTGCAAGCGCCGGAAGGAAGGAGGCGCGCTGCTGCTGCTGGACCGGCAGTACGGCGACTTCCTGCAGCGCAAGTGCCGCGCGGGCGGCGACGGGGAGTACGTGGAGCTGGACGGC
GAGACGCCCACGGCGTTCGACAACCAGTACTACAAGAACCTGGTGCACGGGAAGGGGCTGCTGGACACGGACCAGAAGCTGCTGGCGGACTCCCGGACGGGCGGCTTCGTCAGGTCCTAC
GCCAACCAGAGGTCCCAGGCCTTCGTCGGCCAGTTCGCCCAATCCATGCGACGCCTCGGCGAGGCTCAGGTGCTCACCGGGAACGAGGGCGAGGTCCGCCGCAAGTGCTCCGCCGTCAAC
TACTAA

Retrieve as FASTA