Entry information : SbPrx66 (Sobic.003G250000.1 [2.1] / Sb03g030630 [1.4])
Entry ID 2754
Creation 2008-11-19 (Christophe Dunand)
Last sequence changes 2008-11-19 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx66 (Sobic.003G250000.1 [2.1] / Sb03g030630 [1.4])
Name (synonym) SbPrx66 (Sobic.003G250000.1 [2.1] / Sb03g030630 [1.4])
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx66
start..stop
S start..stop
ZmPrx137 621 0 1..370 1..372
SiPrx02 608 0 1..369 1..365
BdiPrx92 577 0 1..367 1..367
HvPrx25 530 0 4..351 5..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 58833619..58833933 315 N° 2 58834056..58834268 213 N° 3 58835796..58836380 585  
join(58833619..58833933,58834056..58834268,58835796..58836380)


exon

Literature and cross-references SbPrx66 (Sobic.003G250000.1 [2.1] / Sb03g030630 [1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_3 (58833619..58836380)
Protein sequence: SbPrx66 (Sobic.003G250000.1 [2.1] / Sb03g030630 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   370 (336)
PWM (Da):   %s   39616.94 (35955.8)  
PI (pH):   %s   10.25 (9.84) Peptide Signal:   %s   cut: 35 range:35-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSSRGAIRFLVHRRVLLLLLLVASSSLVGTSRGREAQPLPVAAAATVLGSRRAPERHGLALDFYAKTCPAVDQIVGNVTAARYRDFPAAGPAVLRLFHHDCFVEGCDASVLIAPTADAAARSPPRVERDVEENRNLPQEAFDTVELAKAAVESKCPGIVSCADVLALAARDYVQLAGGPYYAVKKGRKDSKVSLAGKVRGSLPRANSTVDELLRVFAGKGLGAADLVALSGAHTVGFAHCVHVLGRIYDFRGTRRPDPLMDGRLVKALRMSCPSSGGSARVVVPFDVSTPFQFDHAYYGNLQARLGLLASDQALFLDARTRPLVQDLAGNKTRFFQAFVASIDRMGSIRIKKGRKGEVRKVCSQHLLSA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCCTCTAGAGGCGCCATCCGCTTCCTCGTCCACCGCCGCGTGCTGCTCCTGCTGCTGCTCGTCGCGTCGTCGTCCCTCGTCGGCACGTCGCGTGGCAGGGAGGCGCAGCCGCTG
CCCGTGGCGGCGGCGGCCACGGTCCTCGGCAGCAGGCGCGCGCCGGAGCGGCACGGGCTGGCGCTGGACTTCTACGCCAAGACGTGCCCCGCGGTCGACCAGATCGTCGGCAACGTCACC
GCCGCCAGGTACAGGGACTTCCCCGCCGCCGGACCCGCCGTGCTCCGCCTCTTCCACCACGACTGCTTCGTCGAA
GTACGTAACCGACCCATTAATTGTTTTGTAAATCATTGCATTGTG
TTCGTTGGTGTCCTGCCGATTTTCGATGACGACGTGAATGCACACGCACACACGCACGCACGCACGCACGCACGCAGGGGTGTGACGCGTCCGTTTTGATCGCGCCGACGGCCGACGCGG
CCGCGCGCTCGCCGCCCAGGGTGGAGCGCGACGTGGAGGAGAACAGGAACCTGCCGCAGGAGGCGTTCGACACGGTGGAGCTTGCCAAGGCCGCCGTGGAGAGCAAGTGCCCCGGCATCG
TCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGAGACTACGTCCAGCTG
GTACGTAACGTACTGTACCTACCGCAACGCAAGCTAACTAGTACTACTGTAGCTCGCGTTCATCTTCCCA
GTCTTCGTTCTCTCTGGCTAGCTTGATTCACGCGAAAAAAAACATAACTGTATGTGTTTTGAGCACAGCATTATGCAACCGAAAGCACGAGCAGATGCAGCAGAGCCTTGGGTTTCAGCG
AGAGAAATAAAGCGATGTGACTCTAGTGCAGCATTCGCGTTTGCAACCGAAACCCAACTGACAGTTAAAAGTTGGTAGGGGGGTACCGTACACTACATTGGCAAAGTCAGGACCAAAGAG
AGGCGAAGCCGGGGACGGGGAAGAAAAGGTTTTACCTGCTTTAATTTGGACTGCCTTTTGCACTGCATGCGGGAAAAACCGAAAAAGGCGCAACCGCACGTCGTGCCCATGGCCGGCCGG
CCGGCATGTGAACGTCGTTAGGATTAGGAACAGGGCGGCGTTACGTACGTTGTTAGCTTAGCTTAGCTTAGCTTAAGCAGGCCGAGCAAGGGCGGCGATGATGATTACATGACCGTGAAG
AGAAACAAACCGTGTTGTCTCGTCTCAGGTTTTGGGATCAATTGCTATATTGATCATCGTAGTAGTGGAAGTAGTAGTACAAGTGCTCCGTGGTCGGTGATCTGCTCAGTGAACTGTTTC
TGCTAATTATGGTGGGTCAGTACTCAGTGGGCTGCAAAGCCTGCAAGTGTGGCCGCCCGTGCAGACACGAGTAGTAGGTTAATTTTAATTTGATTTGTTTAAACGTTTTGCTTCTGAGAT
TAGCACCGTCGCCCATCACACAGTGGCTTTTAATTCACGTCACGTTACGGCAATTTTACCGCGCCCTAGTGATGGATCGGAGTGTAGCCTGAACTGTTTCTAATTTATATTGTCTGTACG
ATTTCCTAATGTAGCTAGGGTGACAACTACGTGACAGCCTCAACGGGTAACACAATTTGAGCTATATATAGTCTAAGCTTGGGGATTCGGCACTCCGTGCTTGGATCTTATGGCCGCAAG
CCAACAAAGTTTGCCTCGCCCATGTCAAGACTCAAGAGCAGCTGATTTGGTGCTGCAACGAGAGTAATTTAGGGCCACGTCGTGTTTTTTAAGTGCGTCAGGTGACACTTGACAGGCAGG
TGGTCGTAAGTGTCGTCCATCACAGCCTCTGAGCGAGTCAAGTGTCGTGTTCCTCCCTTTCCCGCAGAAGTCAAGCGTCCAACCTGTCCCTCGCTTTGTTGCGTAGTACCACGGCCGCCC
ATTTTGGAGTCGTCTCGTGCATCTTTCTGGACCACGCTGCCTCTTTTTTTTTCTTTTTATTTTTGGTAACAGACCACGCTGCCTTGATACAAACGGCCAAAGTCCACGGCTCGTAATTTT
CGTTCTATATTTTTAAAGTTTTATTTATTTTAGAAACAACTTTATTCATTATTTCCAGCCTATAGAAAGAAGCATTTATTTGGCTGAGAAACTCTGTAATGGATGGACCCAACCTAAACA
ATAGTGGCCCATTACAGGCAGGTGGGCCGTATTACGCGGTGAAGAAGGGCCGTAAGGACAGCAAGGTGTCCCTGGCGGGGAAAGTCCGGGGCAGCCTCCCGCGGGCCAACTCGACGGTGG
ACGAGCTCCTCCGCGTGTTCGCGGGCAAGGGCCTGGGCGCGGCGGACCTGGTGGCGCTGTCCGGCGCGCACACCGTCGGCTTCGCGCACTGCGTCCACGTGCTGGGCCGCATCTACGACT
TCCGGGGCACGCGGCGGCCGGACCCGCTGATGGACGGCCGCCTCGTGAAGGCGCTCCGGATGTCTTGCCCGTCGTCGGGCGGCAGCGCCCGCGTCGTGGTGCCCTTCGACGTGAGCACGC
CGTTCCAGTTCGACCACGCCTACTACGGCAACCTGCAGGCGAGGCTCGGCCTGCTGGCTTCCGACCAGGCGCTGTTCCTGGACGCGCGGACCAGGCCGCTCGTGCAGGACCTCGCCGGCA
ACAAGACCCGCTTCTTCCAGGCGTTCGTGGCCAGCATCGACAGGATGGGCTCCATCCGGATCAAGAAGGGCAGGAAAGGGGAGGTCAGGAAAGTCTGCAGCCAGCACCTGTTGTCAGCCT
GA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCCTCTAGAGGCGCCATCCGCTTCCTCGTCCACCGCCGCGTGCTGCTCCTGCTGCTGCTCGTCGCGTCGTCGTCCCTCGTCGGCACGTCGCGTGGCAGGGAGGCGCAGCCGCTG
CCCGTGGCGGCGGCGGCCACGGTCCTCGGCAGCAGGCGCGCGCCGGAGCGGCACGGGCTGGCGCTGGACTTCTACGCCAAGACGTGCCCCGCGGTCGACCAGATCGTCGGCAACGTCACC
GCCGCCAGGTACAGGGACTTCCCCGCCGCCGGACCCGCCGTGCTCCGCCTCTTCCACCACGACTGCTTCGTCGAA
GGGTGTGACGCGTCCGTTTTGATCGCGCCGACGGCCGACGCGGCC
GCGCGCTCGCCGCCCAGGGTGGAGCGCGACGTGGAGGAGAACAGGAACCTGCCGCAGGAGGCGTTCGACACGGTGGAGCTTGCCAAGGCCGCCGTGGAGAGCAAGTGCCCCGGCATCGTC
TCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGAGACTACGTCCAGCTG
GCAGGTGGGCCGTATTACGCGGTGAAGAAGGGCCGTAAGGACAGCAAGGTGTCCCTGGCGGGGAAAGTCCGG
GGCAGCCTCCCGCGGGCCAACTCGACGGTGGACGAGCTCCTCCGCGTGTTCGCGGGCAAGGGCCTGGGCGCGGCGGACCTGGTGGCGCTGTCCGGCGCGCACACCGTCGGCTTCGCGCAC
TGCGTCCACGTGCTGGGCCGCATCTACGACTTCCGGGGCACGCGGCGGCCGGACCCGCTGATGGACGGCCGCCTCGTGAAGGCGCTCCGGATGTCTTGCCCGTCGTCGGGCGGCAGCGCC
CGCGTCGTGGTGCCCTTCGACGTGAGCACGCCGTTCCAGTTCGACCACGCCTACTACGGCAACCTGCAGGCGAGGCTCGGCCTGCTGGCTTCCGACCAGGCGCTGTTCCTGGACGCGCGG
ACCAGGCCGCTCGTGCAGGACCTCGCCGGCAACAAGACCCGCTTCTTCCAGGCGTTCGTGGCCAGCATCGACAGGATGGGCTCCATCCGGATCAAGAAGGGCAGGAAAGGGGAGGTCAGG
AAAGTCTGCAGCCAGCACCTGTTGTCAGCCTGA

Retrieve as FASTA