Entry information : SbPrx21 (Sobic.001G444700.1[2.1] / Sb01g041790[1.4])
Entry ID 2757
Creation 2008-11-19 (Christophe Dunand)
Last sequence changes 2011-01-24 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx21 (Sobic.001G444700.1[2.1] / Sb01g041790[1.4])
Name (synonym) SbPrx21 (Sobic.001G444700.1[2.1] / Sb01g041790[1.4])
Class Class III peroxidase    [Orthogroup: Prx131]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx21
start..stop
S start..stop
ZmPrx17 563 0 24..331 23..329
SiPrx151 527 0 18..331 26..339
BdiPrx47 478 1e-171 20..331 23..328
OsPrx37 443 1e-157 18..331 20..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 65040703..65040915 213 N° 2 65040402..65040593 192 N° 3 65040121..65040283 163 N° 4 65039562..65039989 428
complement(join(65039562..65039989,65040121..65040283,65040402..65040593,6504070 3..65040915))


exon

Literature and cross-references SbPrx21 (Sobic.001G444700.1[2.1] / Sb01g041790[1.4])
Literature Plant Genome Database
DNA ref. Phytozome 12:   chromosome_1 (65040900..65039562)
Protein sequence: SbPrx21 (Sobic.001G444700.1[2.1] / Sb01g041790[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (308)
PWM (Da):   %s   35283.35 (33187.2)  
PI (pH):   %s   4.8 (4.89) Peptide Signal:   %s   cut: 24 range:24-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVPAMAVAALFALAALGGVAEAQQLSTAYYDGSCPHVYDTVRRVVQEARASDPRILASLLRLHFHDCFVNGCDASLLLDETPTMRSEKAADPNNGSARGFPVVNDIKAALENACPGVVSCADILALAAEVSVELAGGPYWRVMLGRRDGMTANFDGAQDLPNPKEALNDLKQKFADLGLDDTDFVALQGAHTIGRAQCTSFQDRLYNFSGTERADPTLDRSYLAALRESCPAAVSGGNTRLNNLDPATPDTFDNHYYANIQSNRGLLRSDQAMLSATEEGAASTTPIVARFADSQTEFFKSFATAMIKMGNIAPLTGGMGQVRRDCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCGGCGATGGCCGTAGCAGCCCTGTTCGCCCTCGCGGCGCTGGGCGGCGTCGCGGAGGCGCAGCAGCTGAGCACCGCGTACTACGACGGCTCGTGCCCGCACGTCTACGAC
ACGGTGCGGCGCGTGGTCCAGGAGGCGCGCGCCTCCGACCCGCGCATCCTCGCCAGCCTCCTCCGCCTCCACTTCCACGACTGCTTCGTCAAT
GTACGTGCACGCCACGCCGCCCCATGC
ATGGCGGTAGCTGCCAAAGCCGTGTGTGCCAGAGAACCGATCTGACTCTGAACGGTGCTCGATTGATCGTGTGCTCGTGCAGGGTTGTGACGCGTCGCTGCTGCTCGACGAGACCCCGAC
GATGCGCAGCGAGAAGGCAGCCGACCCCAACAACGGCTCCGCGCGGGGGTTCCCCGTGGTGAACGACATCAAGGCCGCCCTGGAGAACGCCTGCCCAGGCGTCGTCTCCTGCGCTGACAT
CCTCGCCCTGGCCGCCGAGGTCTCCGTCGAGCTG
GTTAGTGCTCTGACACGACATATATAGACGGTGCGAAGTTACCGTCGATCGAGAGCAACACTGCGGCTAGGGATCACTACTAATTA
TGCCGTTTTCCTGACTGGATATATATGAGCAGGCAGGAGGTCCGTACTGGAGGGTGATGCTGGGCCGGAGGGACGGCATGACGGCTAACTTCGACGGCGCCCAGGACCTCCCAAACCCGA
AGGAAGCATTGAACGATCTGAAGCAGAAGTTCGCCGACCTCGGCCTCGACGACACCGATTTTGTTGCCCTCCAAG
GTATTCTCATCTAGCACACGGAACCACACACACACACACACGCAC
ACACACAACCGAAACTCAAGTATGTGCGGCCACCTGCTGAGCTCAAATCAAAATCAAATGTTGACGTGCCTCGTTGCACCATGCAGGGGCACACACGATCGGCCGCGCCCAGTGCACGTC
CTTCCAGGACAGGCTCTACAACTTCAGCGGCACGGAGCGGGCGGACCCGACGCTGGACCGGTCCTACCTCGCCGCGCTCCGGGAGAGCTGCCCGGCGGCGGTGAGCGGCGGCAACACGCG
CCTGAACAACCTCGACCCGGCCACGCCGGACACGTTCGACAACCACTACTACGCCAACATCCAGAGCAACCGCGGCCTGCTCAGGTCCGACCAGGCGATGCTCTCCGCGACGGAGGAGGG
CGCGGCGTCCACCACGCCGATCGTCGCGCGGTTCGCCGACAGCCAGACCGAGTTCTTCAAAAGCTTCGCGACGGCCATGATCAAGATGGGGAACATCGCGCCCCTCACCGGGGGAATGGG
GCAGGTCAGGAGGGACTGCAGGGTGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTCCCGGCGATGGCCGTAGCAGCCCTGTTCGCCCTCGCGGCGCTGGGCGGCGTCGCGGAGGCGCAGCAGCTGAGCACCGCGTACTACGACGGCTCGTGCCCGCACGTCTACGAC
ACGGTGCGGCGCGTGGTCCAGGAGGCGCGCGCCTCCGACCCGCGCATCCTCGCCAGCCTCCTCCGCCTCCACTTCCACGACTGCTTCGTCAAT
GGTTGTGACGCGTCGCTGCTGCTCGAC
GAGACCCCGACGATGCGCAGCGAGAAGGCAGCCGACCCCAACAACGGCTCCGCGCGGGGGTTCCCCGTGGTGAACGACATCAAGGCCGCCCTGGAGAACGCCTGCCCAGGCGTCGTCTCC
TGCGCTGACATCCTCGCCCTGGCCGCCGAGGTCTCCGTCGAGCTG
GCAGGAGGTCCGTACTGGAGGGTGATGCTGGGCCGGAGGGACGGCATGACGGCTAACTTCGACGGCGCCCAGGAC
CTCCCAAACCCGAAGGAAGCATTGAACGATCTGAAGCAGAAGTTCGCCGACCTCGGCCTCGACGACACCGATTTTGTTGCCCTCCAAG
GGGCACACACGATCGGCCGCGCCCAGTGCACG
TCCTTCCAGGACAGGCTCTACAACTTCAGCGGCACGGAGCGGGCGGACCCGACGCTGGACCGGTCCTACCTCGCCGCGCTCCGGGAGAGCTGCCCGGCGGCGGTGAGCGGCGGCAACACG
CGCCTGAACAACCTCGACCCGGCCACGCCGGACACGTTCGACAACCACTACTACGCCAACATCCAGAGCAACCGCGGCCTGCTCAGGTCCGACCAGGCGATGCTCTCCGCGACGGAGGAG
GGCGCGGCGTCCACCACGCCGATCGTCGCGCGGTTCGCCGACAGCCAGACCGAGTTCTTCAAAAGCTTCGCGACGGCCATGATCAAGATGGGGAACATCGCGCCCCTCACCGGGGGAATG
GGGCAGGTCAGGAGGGACTGCAGGGTGGTGAACTGA

Retrieve as FASTA