Entry information : SbPrx83 (Sobic.005G011200.1 [2.1] / SB05G001000 [1.4])
Entry ID 2760
Creation 2008-10-12 (Christophe Dunand)
Last sequence changes 2014-01-08 (Qiang Li)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx83 (Sobic.005G011200.1 [2.1] / SB05G001000 [1.4])
Name (synonym) SbPrx83 (Sobic.005G011200.1 [2.1] / SB05G001000 [1.4])
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx83
start..stop
S start..stop
ZmPrx115 595 0 1..331 28..360
SiPrx111 588 0 32..331 32..331
SbPrx84 579 0 30..331 27..328
SiPrx54 578 0 14..331 5..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1929..2175 247 N° 2 1643..1835 193 N° 3 1355..1525 171 N° 4 1..389 389
complement(join(1..389,1355..1525,1643..1835,1929..2175))


exon

Literature and cross-references SbPrx83 (Sobic.005G011200.1 [2.1] / SB05G001000 [1.4])
Literature Plant genome Database
DNA ref. Phytozome 12:   chromosome_5 (1001461..998634)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.6734.1
Protein sequence: SbPrx83 (Sobic.005G011200.1 [2.1] / SB05G001000 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (296)
PWM (Da):   %s   34572.97 (31337.3) Transmb domain:   %s   i13-35o
PI (pH):   %s   7.24 (6.87) Peptide Signal:   %s   cut: 36 range:36-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPASAATKCSSSCSASGLALLLLLVLMAAGTSSAQLSTSFYSSSCPGVYDSVKSAIQSAIATEQRMGASIVRLFFHDCFVQGCDASLLLDDTASFQGEKMATPNNGSVRGFEVIDAVKSAVEKVCPGVVSCADILAIAARDSVVILGGPSWDVKVGRRDSTTASFSGANNNIPPPTSGLANLTSLFAAQGLSQKDMVALSGAHTIGQARCTNFRAHVYNDTNIDGTFARTRQSGCPRTSGSGDNNLAPLDLQTPTVFENNYYKNLVCKKGLLHSDQELFNGGATDAQVQSYISSQSTFFSDFVTGMIKMGDITPLTGSNGQIRKNCRMIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 4 introns => extra introns between GRRD and VALS). No EST. In DNA sequence there is overlapping seq due to the bad assembly. The dna seq below is the DNA reassemblied. The extra intron is not really existing. Containing intron shift.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCAGCATCAGCTGCAACAAAATGCAGCAGCAGCTGCAGCGCCAGCGGCCTCGCTCTGCTGTTGCTCCTCGTGCTAATGGCGGCCGGCACCTCGTCGGCGCAGCTGTCCACCAGC
TTCTACTCCTCCTCGTGCCCCGGCGTGTACGACTCCGTCAAGTCGGCGATACAATCCGCCATCGCCACCGAGCAGCGCATGGGCGCCTCCATCGTCCGCCTCTTCTTCCACGACTGCTTC
GTCCAAG
TACGTTAGTTAGCTAGCAGATGAATTCGATGCATGGACGATCGATCTCTCAAATGAATGTTCTTATAATTTGCATCCATGTATATATGTATAGGGCTGCGACGCGTCGCTGCT
GTTGGACGACACGGCCAGCTTTCAGGGCGAGAAGATGGCGACGCCCAACAACGGCTCCGTGCGAGGCTTCGAGGTCATCGATGCCGTCAAGTCCGCCGTCGAGAAGGTGTGCCCCGGCGT
CGTCTCCTGTGCTGACATCCTCGCCATCGCTGCTAGGGACAGCGTCGTCATAG
TGAGTAGTAGTGCTTGCACGCACCTCTCAAAGTCTCTGTGATCGACACTGTATGAAGCAAGTGTCTG
ATGGATGCTGATGCTGATCGATATATATATATATATATATATATATGCAGCTGGGTGGTCCAAGCTGGGACGTCAAGGTCGGGCGGCGCGACTCCACGACGGCTAGCTTCAGCGGCGCCA
ACAACAACATCCCGCCGCCGACGTCGGGCCTCGCCAACCTCACCTCGCTCTTCGCCGCGCAGGGCCTCTCTCAAAAGGACATGGTCGCGCTCTCTGGTGCG
TGTGTAATATTCTCATGTT
TTTTTTCCATAAAAAATATTGTTTCTCAAACGCAAATATATACGGATTGGAATTATATTACAAGGAGGCATATATATATATGTAAGAATATATTGCAACAGCTAGCCTTTACACGTACAC
TCTACTACTAAACAATGTAGCTTTGTTAGGTGTGGAAGATGCAGTTGGTAGATATATGGGAATTTGATACAGTTCCGTTTTGACTTGGAAGCTTCACTCTCTTCGTCGTCACATATATTA
TCAAGCTGTGACATGTGCATGAATAGCGTAATTTTGGCAGTTATAGTTAGAAAGACTACACAAATAATTAGTGTTGGCCCATGTGTGTTCATACTACTAAATATATATGTTTTATTAAAA
TTTTGTCATATGAAAGTTGGACCGAAACAGTTGTATCTGCGTAGTTATACAAAATGGTAAAAGAGGTGACATTACCACATATTGTCGGCAGGGTTTTCTTGTAGAAAGTTCTTTGCCCAA
AGCTTTAACTTTATTTCTAATCCTGCCTCTAACTAGATAGCAAATTTAGTGAACTTTCGATGGTTGAAAGATCAGTCTTCCACCTAACATCTTAATTCGACGAAATACTAATAAAACATG
CATGCATAAAAGTACTTGCACATTATACACATACCAAGATCAAGTTAGGTACAAACAGTACATGTGGTTCCTTTTGTTTCGATTCCATTCATTCCTATATATAATCAGATACCTTTATCT
CAATTTTTTTTAGAAATTTAGACAATCAAGAACAACAGCATGTATGTCTTTTTTTTAAAAAAAAAACAAGAAGATGCTTCCAAAAGTTATGTGCTAATTTAAGCTGTACATAATTCAATT
TCTCCATCACCACATTTGTAACTTTCGATCATGCAGCTATATATAGTAATAATCTAAGTTATTAAGCATTTTTGTTTGTGTAATATAATGCCTCTTTTGATAGGAGCTCACACCATTGGC
CAAGCACGTTGCACCAACTTCAGAGCTCACGTATACAATGACACTAACATCGATGGCACCTTCGCAAGAACAAGGCAATCAGGCTGCCCTAGAACCTCAGGTTCAGGTGACAACAATTTG
GCGCCTCTGGACCTTCAAACCCCAACCGTCTTTGAGAACAACTACTACAAGAACCTTGTTTGCAAGAAGGGGCTTCTACACTCCGACCAGGAGCTCTTCAATGGCGGAGCCACCGATGCG
CAAGTTCAATCATACATTAGTAGCCAGAGCACATTCTTCTCGGATTTTGTGACAGGCATGATAAAGATGGGTGACATCACACCGTTGACCGGCTCCAATGGACAGATCAGGAAGAACTGC
AGAATGATTAACTAA

Retrieve as FASTA