Entry information : SbPrx142 (Sobic.010G245500.1 [2.1] / Sb10g028480 [1.4])
Entry ID 2763
Creation 2008-11-19 (Christophe Dunand)
Last sequence changes 2011-01-21 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx142 (Sobic.010G245500.1 [2.1] / Sb10g028480 [1.4])
Name (synonym) SbPrx142 (Sobic.010G245500.1 [2.1] / Sb10g028480 [1.4])
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx142
start..stop
S start..stop
ZmPrx50 550 0 19..318 19..317
SiPrx35 543 0 1..318 1..319
SbPrx141 509 0 19..318 21..320
ZmPrx133 506 0 6..318 9..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 58284957..58285175 219 N° 2 58285309..58285506 198 N° 3 58285694..58285853 160 N° 4 58285936..58286315 380
join(58284957..58285175,58285309..58285506,58285694..58285853,58285936..58286315 )


exon

Literature and cross-references SbPrx142 (Sobic.010G245500.1 [2.1] / Sb10g028480 [1.4])
Literature JGI
DNA ref. Phytozome 12:   chromosome_10 (58284957..58286315)
Protein sequence: SbPrx142 (Sobic.010G245500.1 [2.1] / Sb10g028480 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (302)
PWM (Da):   %s   34076.91 (32351.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.15 (5.82) Peptide Signal:   %s   cut: 17 range:17-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARLRLVLFVAVVVSAALLPPPAAVAQLRTDYYASTCPNLESIVRGSVRQSMAQSQIAAPAALRLFFHDCAVMGCDASIMIVNSTGDDEWRNSANQSLKPDGFQAILSAKAAVDSNQQCQYKVSCADIIALAAREAVYLSGGPYYQVELGRFDGRVSTRDSVRLPSVNFNLDQLNAFFSGLGFSQAEMIALLGAHTLGAADCPFFQYRIGSDPSMDQGLASQLRGTCGSNPNSGFAFFDPTPVSFDNAFYRNLQGGRGLLGSDQVLYSDQRSRSAVDNYVSNQGAFFTDFVAAITKLGRIGAKTAATGEIRRDCRFPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGGCTTAGGCTGGTCTTGTTTGTCGCCGTCGTCGTGTCCGCGGCGCTCCTGCCGCCGCCCGCCGCCGTCGCGCAGCTGAGGACGGACTACTACGCCAGCACCTGCCCCAACCTC
GAGTCCATCGTCCGGGGCTCCGTCAGGCAGTCCATGGCGCAGTCCCAGATCGCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCATG
GTACGCCCAGACTCCATCCTC
TCCTCTCGCAAGCAGCGCAATAGCGCGTGCAGCCGATCGATCGACCGAGCTCAACCGTCGTGTGCGCCATCCACTGATCAACGACCGAACGTCGATCGTCTGAATGATGCAGGGCTGCGA
CGCGTCGATCATGATCGTGAACTCGACCGGCGACGACGAGTGGCGGAACTCCGCCAACCAGTCGCTCAAGCCGGATGGGTTCCAGGCCATTCTGAGCGCCAAGGCCGCCGTGGACAGCAA
CCAGCAGTGCCAGTACAAGGTGTCGTGCGCGGACATCATCGCCCTCGCCGCCAGAGAAGCCGTCTACCTG
GTACGTACGTGCGCTATTCGTCATCTTCCATGCATGCTTCCATGTTACAT
ATACACCTTCTACAAGCATGCATATATGTTGTCAGTCGTTGGTACTTTGTTCAAAAAGAAATCTTTGTCATCAGTTGCATATATATGCTGTGCAAGTGTGCATGATGCAACTAACTTTCT
GCATGCATCGGTTGCAGAGTGGCGGGCCGTACTACCAGGTGGAGCTCGGCCGGTTTGACGGCAGGGTGTCGACCAGAGACAGCGTCCGGCTGCCGAGCGTCAACTTCAACCTCGACCAGC
TCAACGCCTTCTTCTCCGGCCTCGGCTTCTCCCAGGCTGAAATGATCGCCCTCCTAG
GTAAACGGCACCGCCGGCGGCTGCTCGTCTCGCAATTGCCAACCTGATCGATCCTGACCTTGC
CAATGCAATCCACCTGCAGGTGCGCACACCCTCGGCGCGGCGGACTGCCCCTTCTTCCAGTACAGGATCGGTAGCGACCCGAGCATGGACCAGGGCCTGGCGTCGCAGCTGCGCGGCACC
TGCGGCTCCAACCCCAACAGCGGCTTCGCGTTCTTCGACCCCACGCCGGTGAGCTTCGACAACGCCTTCTACCGGAACCTGCAGGGCGGCAGGGGGCTGCTGGGCTCCGACCAGGTGCTG
TACAGCGACCAGAGATCCCGCAGTGCCGTCGACAACTACGTGTCCAACCAGGGCGCCTTCTTCACCGACTTCGTCGCGGCGATCACCAAGCTCGGCAGGATCGGAGCCAAGACGGCGGCC
ACCGGCGAGATACGCCGCGACTGCCGGTTCCCGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGGCTTAGGCTGGTCTTGTTTGTCGCCGTCGTCGTGTCCGCGGCGCTCCTGCCGCCGCCCGCCGCCGTCGCGCAGCTGAGGACGGACTACTACGCCAGCACCTGCCCCAACCTC
GAGTCCATCGTCCGGGGCTCCGTCAGGCAGTCCATGGCGCAGTCCCAGATCGCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCATG
GGCTGCGACGCGTCGATCATG
ATCGTGAACTCGACCGGCGACGACGAGTGGCGGAACTCCGCCAACCAGTCGCTCAAGCCGGATGGGTTCCAGGCCATTCTGAGCGCCAAGGCCGCCGTGGACAGCAACCAGCAGTGCCAG
TACAAGGTGTCGTGCGCGGACATCATCGCCCTCGCCGCCAGAGAAGCCGTCTACCTG
AGTGGCGGGCCGTACTACCAGGTGGAGCTCGGCCGGTTTGACGGCAGGGTGTCGACCAGAGAC
AGCGTCCGGCTGCCGAGCGTCAACTTCAACCTCGACCAGCTCAACGCCTTCTTCTCCGGCCTCGGCTTCTCCCAGGCTGAAATGATCGCCCTCCTAG
GTGCGCACACCCTCGGCGCGGCG
GACTGCCCCTTCTTCCAGTACAGGATCGGTAGCGACCCGAGCATGGACCAGGGCCTGGCGTCGCAGCTGCGCGGCACCTGCGGCTCCAACCCCAACAGCGGCTTCGCGTTCTTCGACCCC
ACGCCGGTGAGCTTCGACAACGCCTTCTACCGGAACCTGCAGGGCGGCAGGGGGCTGCTGGGCTCCGACCAGGTGCTGTACAGCGACCAGAGATCCCGCAGTGCCGTCGACAACTACGTG
TCCAACCAGGGCGCCTTCTTCACCGACTTCGTCGCGGCGATCACCAAGCTCGGCAGGATCGGAGCCAAGACGGCGGCCACCGGCGAGATACGCCGCGACTGCCGGTTCCCGAACTAG

Retrieve as FASTA