Entry information : SbRboh01 (Sobic.003G161500.1 [2.1] / Sb03g014430 [1.4])
Entry ID 2765
Creation 2008-10-24 (Christophe Dunand)
Last sequence changes 2008-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-06 (Messaoudi)
Peroxidase information: SbRboh01 (Sobic.003G161500.1 [2.1] / Sb03g014430 [1.4])
Name (synonym) SbRboh01 (Sobic.003G161500.1 [2.1] / Sb03g014430 [1.4])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducers Brassinolide treatment
Gibberellic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh01
start..stop
S start..stop
ZmRboh24 1722 0 13..908 1..895
OsRboh01 1646 0 9..908 4..905
EgrRboh04 1197 0 28..908 15..889
CsRboh03 1197 0 37..908 27..889
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19301580..19302150 571 N° 2 19301336..19301495 160 N° 3 19301051..19301099 49 N° 4 19300849..19300962 114
N° 5 19300343..19300774 432 N° 6 19299755..19300141 387 N° 7 19299582..19299674 93 N° 8 19299197..19299312 116
N° 9 19299003..19299105 103 N° 10 19298746..19298825 80 N° 11 19298145..19298656 512 N° 12 19297903..19298012 110
complement(join(19297903..19298012,19298145..19298656,19298746..19298825,1929900 3..19299105,19299197..19299312,19299582..19299674,19299755..19300141,19300343..1 9300774,19300849..19300962,19301051..19301099,19301336..19301495,19301580..19302 150))


exon

Literature and cross-references SbRboh01 (Sobic.003G161500.1 [2.1] / Sb03g014430 [1.4])
Literature Cordonnier-Pratt,M.-M., Suzuki,Y., Sugano,S., Klein,R., Brady,J., Liang,C., Sun,F. and Pratt,L.H. A Sorghum EST database: seedlings treated with gibberellic acid or brassinolide. Unpublished (2005)
DNA ref. Phytozome 11:   chromosome_3 (19302150..19297903)
Cluster/Prediction ref. UniGene:   Sbi.11001 [Fragment]
Protein sequence: SbRboh01 (Sobic.003G161500.1 [2.1] / Sb03g014430 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   908
PWM (Da):   %s   102060.57 Transmb domain:   %s   o359-378i499-521o541-563i724-741o
PI (pH):   %s   9.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
SRENLASAVEKDMAATEAAMDTGSSRRSQDDTATLIPHSGNLGESSQKGVKTTRFKDDDEVVEITIVQRDSVAIEDVRAVDDGSGHGGGFDGLSLVSPSSSRSGKLSSKIRQVKNGLKMKSSSSKAPQTQLGKNVRKRLNRSKSGAAVALKGLQFVTAKVGHDGWAAVEKRFNQLQVDGVLLRSRFGKCIGMDGSDEFAVQVFDSLARKRGITKQLLTKDELKDFWEQLSDQGFDNRLQTFFDMVDKNADGRITAEEVKIITLSASANKLSKLKDRADEYTALIMEELDRDNLGYIELEDLEALLLQSPSQAAARSTTQSSKLSKALSMKLASNKNTGPLYHYWQEFMYFLEENWKRIWVMTLWLSICIGLFIWKFIQYRNRAVFHIMGYCVCTAKGAAETLKFNMALVLFPVCRNTITWIRSKTKIGAVVPFNDNINFHKVIAAGVAVGVALHAGAHLTCDFPRLLHASDVAYEPMKPFFGDKRPPNYWWFVKGTEGWTGVVMVVLMTIAFVLAQPWFRRNRLKDSNPLKKMTGFNAFWFTHHLFVIVYALLVVHGICLYLSRKWYKKTTWMYLAVPVLLYVSERIIRLFRSHDAVRIQKVAVYPGNVLALYMSKPPGFRYRSGQYIFINCRAVSPYEWHPFSITSAPGDDYLSVHIRTRGDWTSRLRTVFSACRPPTDGESGLLRADLSKGITESNARFPKLLIDGPYGAPAQDYREYDVLLLIGLGIGATPLISIVKDVLNHIQHGGSVAGTEPDGSGKAKKRPFMTKRAYFYWVTREEGSFEWFRGVMNEVAEKDKDGVIELHNHCSSVYEEGDARSALIVMLQELQHAKKGVDILSGTSVKTHFARPNWRSVFKHVAVNHENQRGVFYCGEPVLVPQLRQFSADFTHKTNTKFEFHKENF

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 3, 11 introns) and 7 ESTs + BI098845, BG948662.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGTAGGGAGAACTTGGCCTCAGCGGTAGAGAAGGATATGGCAGCCACTGAAGCGGCCATGGACACAGGCAGTTCAAGGAGGTCACAAGATGACACCGCAACATTAATCCCCCACAGTGGC
AATTTGGGAGAATCAAGCCAGAAGGGCGTGAAGACCACCAGGTTCAAAGATGATGACGAGGTTGTGGAAATCACCATTGTACAGCGTGATTCAGTGGCAATCGAAGATGTCAGGGCAGTC
GATGACGGCTCCGGACATGGTGGTGGGTTTGATGGACTGTCACTTGTGTCACCTTCCTCATCAAGGAGCGGCAAGCTGTCATCGAAGATTAGGCAGGTGAAAAATGGGTTAAAGATGAAG
AGCTCAAGCAGTAAGGCGCCACAGACACAGTTGGGAAAGAACGTGAGGAAGAGATTGAACAGAAGCAAGAGTGGCGCTGCTGTAGCACTCAAGGGCTTGCAGTTTGTGACTGCAAAAGTT
GGTCATGATGGCTGGGCTGCAGTGGAGAAACGGTTCAACCAGCTACAGGTTGATGGCGTGCTGCTACGTTCAAGATTTGGGAAATGCATTG
GTAATTTCAGTGGGTCTATTGAATATGTA
TCTCCATACAGCTATTTGAACAATGCTAATACAAGCATTGCTTTGGATTGTGCAGGGATGGATGGATCTGATGAGTTTGCAGTGCAAGTCTTTGATTCATTAGCAAGGAAGAGAGGGATA
ACGAAGCAGCTGCTGACTAAGGATGAGCTGAAAGATTTCTGGGAGCAACTCAGTGATCAGGGTTTTGACAACCGTCTACAGACGTTCTTTGACAT
GTTAGTAATTTTGATGAATATCTTA
TTAGTCCTGGCATGGTTTCCTTCTTTATGCATAACTGTATGTGATGCATTATCAAAATCCTCCTCCATATGAAAAAAAAAACTTGGCCTTACTCATAACATGTTATCTTAAAAAAAACTA
TGAAGCAAACTATTGTAATAAGTTTACACCAGCTGTTGTGTATTCAACAATTTTATTTGGCACCTACCATATGTTAATTTTTTCTGTTCAGGGTTGACAAGAATGCTGATGGAAGGATCA
CAGCAGAGGAGGTTAAGGAG
GTCTGTCAGAAGAATCAAGAATTAAAAATCTGATATGTTCATGCTGTGTGTTGTAAGGTGCTAAGTAAGTGATAATATGCTCTTGCAGATTATTACCCTC
AGTGCTTCAGCAAACAAACTTTCCAAGCTCAAGGACCGGGCTGATGAGTACACAGCACTCATTATGGAAGAACTTGACCGCGACAATCTGGGATACATTGAG
GTCTGCCTAATATACTCA
CAAAAATAACAATTGTGGCACAGTCCATGAACTAACTCATGCTAAAAAATTAACAGCTTGAGGATCTGGAGGCACTTTTGCTGCAATCGCCATCTCAAGCTGCTGCAAGATCGACAACAC
AAAGCTCAAAACTTAGCAAAGCTCTTAGCATGAAGCTTGCATCAAACAAGAACACAGGTCCACTTTACCACTACTGGCAAGAGTTCATGTACTTCCTTGAGGAGAACTGGAAGCGCATTT
GGGTTATGACTCTCTGGCTCTCAATCTGCATTGGCCTCTTCATTTGGAAGTTCATCCAATACCGTAATCGAGCCGTATTTCACATCATGGGTTATTGTGTGTGCACTGCAAAAGGTGCTG
CAGAGACCCTCAAATTCAATATGGCCCTGGTTCTTTTTCCTGTTTGCCGAAATACAATCACTTGGATTCGATCAAAGACAAAGATCGGAGCTGTTGTGCCCTTCAATGACAACATAAACT
TCCATAAG
GTAAGACTATATGTACTCAGTATTGAACACAGGATGAACCTTTCCATTCTGTGGGAGTATCCATTCCAATTGAAACATAGTTCTCTTTTTTTATCCTAGACTAGAGGACCCA
TGAGAATGAATTGTTAACCTTCCCATCTGATAGTTACACTTACTAATGTGGAAATTACATTATGTAATATGTATGGAATTATTGTGCAGGTAATAGCAGCAGGTGTTGCAGTTGGTGTTG
CTTTGCATGCAGGTGCTCACCTGACATGTGATTTTCCTCGGCTGCTCCATGCAAGTGATGTTGCCTATGAACCAATGAAGCCTTTCTTCGGAGACAAAAGGCCACCAAATTATTGGTGGT
TTGTAAAGGGAACTGAAGGGTGGACAGGTGTGGTCATGGTTGTACTTATGACTATAGCTTTTGTATTGGCCCAGCCATGGTTTCGGCGTAATAGGCTCAAGGATTCTAATCCCCTTAAGA
AAATGACTGGCTTCAATGCCTTTTGGTTTACGCACCACTTATTTGTTATTGTGTATGCACTGCTCGTTGTCCATGGGATCTGCTTATATCTAAGCAGGAAATGGTACAAGAAAACG
GTAA
ACATATGTACACTCATTGGCTAGAGAGCATCTAATTTCTGAAAGTTAATAGTTACAGAGCATTTCTACCATTGCAGACTTGGATGTACCTTGCTGTCCCTGTGCTCCTGTATGTAAGTGA
GCGCATTATTCGGCTATTTAGGAGCCATGATGCTGTTAGGATTCAGAAG
GTACCTACAATTCCATTCCTTTGGTTTTGCATTCATTTTTTTAACTTGCATATGATGAGAACAAAGCAAAG
TTCAGTTAGTAGGTGTGCAGTGTGCTATACACCCTTCCACCCAAGTTCTGTGTTCAACCCGAATTTCAGTGTCTATTTTCTTTCATTCTACAAAGATACCTACTTACTCTGCAGTGTTTC
ATTTTATTTATTTATGAGAAGTCATTTTGAAAGTTATGGTTTTTCTTTTTGACTTCTAATTTTGTGCCCTCTCAATAGGTTGCAGTATATCCAGGGAATGTTTTGGCTCTCTATATGTCC
AAGCCACCTGGATTCAGGTACCGGAGTGGGCAGTATATCTTCATAAACTGCCGTGCTGTCTCTCCATACGAATG
GTAGGCAGTTACACCCTTCCTCAAGGAAAGTGATGTACCTCAACTA
TATGATCAGCATATGACTGAAGTGCATAATATTTTTCTCTTGCAGGCACCCATTTTCCATTACATCAGCACCAGGAGATGATTATCTTAGTGTCCACATTCGCACAAGGGGTGATTGGAC
TTCACGTCTTAGGACTGTCTTCTCTGAG
GTAATTTGACTCCTAGGTTTTGAGTTTTTATTGGTCCAATAAGATCCTTGTAGAACAAGACTCAACAACTCTTGGAGGATGGTGAACACAAC
TTGTGAAATTTGTTATTTGTGAACTTTGATATCTGATGCCATTGCTTTTGTTGTTGGAACTGACAATTATGTAAATATGAACCAGGCATGCCGTCCTCCAACTGATGGAGAAAGTGGACT
CCTCAGAGCTGACCTTTCCAAGGGGATCACTGAGAGCAACGCCAG
GTAGAATTTGTTTGATTTGTTTTGAAATGTAGTACAGTAAAATATACATTTCTTAGATTCATTGGACCCTGAAGT
TTGACATGCTCTAGGTTCCCAAAACTCTTAATTGATGGACCATATGGTGCTCCGGCACAAGACTATCGGGAATATGATGTGCTCCTGCTCATTGGACTAGGCATTGGAGCCACTCCATTG
ATTAGCATTGTGAAGGATGTACTTAACCACATTCAGCATGGAGGATCTGTTGCAGGCACCGAGCCTGACGGCAGTGGCAAGGCCAAGAAGAGGCCATTCATGACAAAGAGAGCCTACTTC
TACTGGGTGACCAGAGAAGAGGGATCTTTTGAATGGTTCCGAGGGGTCATGAATGAGGTGGCTGAGAAGGACAAGGATGGAGTCATTGAACTCCACAACCACTGCTCGAGTGTGTACGAG
GAAGGGGATGCACGTTCTGCCCTCATTGTCATGCTCCAAGAGCTCCAGCACGCAAAAAAGGGAGTCGACATCTTGTCTGGAACTAGTGTCAAGACGCACTTTGCGCGTCCCAATTGGCGA
AGCGTCTTCAAACATGTTGCAGTGAACCATGAGAACCAACGCGTCG
GTATGTCATATCCTTTGTCGTCTCCCTATCATGCCGAAGCACTAGAAACGTTCTCTGTCGTCTTCCTATCGTGT
CGAAGCACTAGAAACATCAATTGACTTCATCATCTACTAACATCTGATTACTGTTCAGGAGTTTTCTACTGCGGTGAGCCCGTCCTTGTGCCACAGCTACGGCAGTTTTCAGCAGACTTC
ACCCACAAGACAAATACAAAGTTTGAGTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGTAGGGAGAACTTGGCCTCAGCGGTAGAGAAGGATATGGCAGCCACTGAAGCGGCCATGGACACAGGCAGTTCAAGGAGGTCACAAGATGACACCGCAACATTAATCCCCCACAGTGGC
AATTTGGGAGAATCAAGCCAGAAGGGCGTGAAGACCACCAGGTTCAAAGATGATGACGAGGTTGTGGAAATCACCATTGTACAGCGTGATTCAGTGGCAATCGAAGATGTCAGGGCAGTC
GATGACGGCTCCGGACATGGTGGTGGGTTTGATGGACTGTCACTTGTGTCACCTTCCTCATCAAGGAGCGGCAAGCTGTCATCGAAGATTAGGCAGGTGAAAAATGGGTTAAAGATGAAG
AGCTCAAGCAGTAAGGCGCCACAGACACAGTTGGGAAAGAACGTGAGGAAGAGATTGAACAGAAGCAAGAGTGGCGCTGCTGTAGCACTCAAGGGCTTGCAGTTTGTGACTGCAAAAGTT
GGTCATGATGGCTGGGCTGCAGTGGAGAAACGGTTCAACCAGCTACAGGTTGATGGCGTGCTGCTACGTTCAAGATTTGGGAAATGCATTG
GGATGGATGGATCTGATGAGTTTGCAGTG
CAAGTCTTTGATTCATTAGCAAGGAAGAGAGGGATAACGAAGCAGCTGCTGACTAAGGATGAGCTGAAAGATTTCTGGGAGCAACTCAGTGATCAGGGTTTTGACAACCGTCTACAGACG
TTCTTTGACAT
GGTTGACAAGAATGCTGATGGAAGGATCACAGCAGAGGAGGTTAAGGAGATTATTACCCTCAGTGCTTCAGCAAACAAACTTTCCAAGCTCAAGGACCGGGCTGATGAG
TACACAGCACTCATTATGGAAGAACTTGACCGCGACAATCTGGGATACATTGAG
CTTGAGGATCTGGAGGCACTTTTGCTGCAATCGCCATCTCAAGCTGCTGCAAGATCGACAACACAA
AGCTCAAAACTTAGCAAAGCTCTTAGCATGAAGCTTGCATCAAACAAGAACACAGGTCCACTTTACCACTACTGGCAAGAGTTCATGTACTTCCTTGAGGAGAACTGGAAGCGCATTTGG
GTTATGACTCTCTGGCTCTCAATCTGCATTGGCCTCTTCATTTGGAAGTTCATCCAATACCGTAATCGAGCCGTATTTCACATCATGGGTTATTGTGTGTGCACTGCAAAAGGTGCTGCA
GAGACCCTCAAATTCAATATGGCCCTGGTTCTTTTTCCTGTTTGCCGAAATACAATCACTTGGATTCGATCAAAGACAAAGATCGGAGCTGTTGTGCCCTTCAATGACAACATAAACTTC
CATAAG
GTAATAGCAGCAGGTGTTGCAGTTGGTGTTGCTTTGCATGCAGGTGCTCACCTGACATGTGATTTTCCTCGGCTGCTCCATGCAAGTGATGTTGCCTATGAACCAATGAAGCCT
TTCTTCGGAGACAAAAGGCCACCAAATTATTGGTGGTTTGTAAAGGGAACTGAAGGGTGGACAGGTGTGGTCATGGTTGTACTTATGACTATAGCTTTTGTATTGGCCCAGCCATGGTTT
CGGCGTAATAGGCTCAAGGATTCTAATCCCCTTAAGAAAATGACTGGCTTCAATGCCTTTTGGTTTACGCACCACTTATTTGTTATTGTGTATGCACTGCTCGTTGTCCATGGGATCTGC
TTATATCTAAGCAGGAAATGGTACAAGAAAACG
ACTTGGATGTACCTTGCTGTCCCTGTGCTCCTGTATGTAAGTGAGCGCATTATTCGGCTATTTAGGAGCCATGATGCTGTTAGGATT
CAGAAG
GTTGCAGTATATCCAGGGAATGTTTTGGCTCTCTATATGTCCAAGCCACCTGGATTCAGGTACCGGAGTGGGCAGTATATCTTCATAAACTGCCGTGCTGTCTCTCCATACGAA
TG
GCACCCATTTTCCATTACATCAGCACCAGGAGATGATTATCTTAGTGTCCACATTCGCACAAGGGGTGATTGGACTTCACGTCTTAGGACTGTCTTCTCTGAGGCATGCCGTCCTCCA
ACTGATGGAGAAAGTGGACTCCTCAGAGCTGACCTTTCCAAGGGGATCACTGAGAGCAACGCCAG
GTTCCCAAAACTCTTAATTGATGGACCATATGGTGCTCCGGCACAAGACTATCGG
GAATATGATGTGCTCCTGCTCATTGGACTAGGCATTGGAGCCACTCCATTGATTAGCATTGTGAAGGATGTACTTAACCACATTCAGCATGGAGGATCTGTTGCAGGCACCGAGCCTGAC
GGCAGTGGCAAGGCCAAGAAGAGGCCATTCATGACAAAGAGAGCCTACTTCTACTGGGTGACCAGAGAAGAGGGATCTTTTGAATGGTTCCGAGGGGTCATGAATGAGGTGGCTGAGAAG
GACAAGGATGGAGTCATTGAACTCCACAACCACTGCTCGAGTGTGTACGAGGAAGGGGATGCACGTTCTGCCCTCATTGTCATGCTCCAAGAGCTCCAGCACGCAAAAAAGGGAGTCGAC
ATCTTGTCTGGAACTAGTGTCAAGACGCACTTTGCGCGTCCCAATTGGCGAAGCGTCTTCAAACATGTTGCAGTGAACCATGAGAACCAACGCGTCG
GAGTTTTCTACTGCGGTGAGCCC
GTCCTTGTGCCACAGCTACGGCAGTTTTCAGCAGACTTCACCCACAAGACAAATACAAAGTTTGAGTTCCACAAGGAGAACTTCTAA

Retrieve as FASTA