Entry information : SbPrx130 (Sobic.010G128400.1 [2.1] / SB10G011510 [1.4])
Entry ID 2768
Creation 2006-01-18 (Christophe Dunand)
Last sequence changes 2011-01-21 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx130 (Sobic.010G128400.1 [2.1] / SB10G011510 [1.4])
Name (synonym) SbPrx130 (Sobic.010G128400.1 [2.1] / SB10G011510 [1.4])
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Inducers Anaerobic stress
Brassinolide treatment
Gibberellic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx130
start..stop
S start..stop
SbPrx129 597 0 12..339 5..332
SiPrx31 585 0 12..339 1..328
SbPrx145 580 0 30..339 21..329
SiPrx30 575 0 12..339 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16768492..16768743 252 N° 2 16768899..16769666 768  
join(16768492..16768743,16768899..16769666)


exon

Literature and cross-references SbPrx130 (Sobic.010G128400.1 [2.1] / SB10G011510 [1.4])
Literature Cordonnier-Pratt,M.-M., Suzuki,Y., Sugano,S., Klein,R., Lim,S., Liang,C., Sun,F. and Pratt,L.H. A Sorghum EST database: anaerobic roots.
DNA ref. Phytozome 12:   chromosome_10 (16768492..16769666)
EST ref. GenBank:   CX608318 [5' end]   CX611382 [3' end]
Cluster/Prediction ref. UniGene:   Sbi.7844
Protein sequence: SbPrx130 (Sobic.010G128400.1 [2.1] / SB10G011510 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (303)
PWM (Da):   %s   36693.53 (32874.4)  
PI (pH):   %s   7.34 (6.66) Peptide Signal:   %s   cut: 37 range:37-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQLTWLRFIAPMAAKSCQVLLLPLVLLLAGSSLAVADQLEVGYYSKTCPNVEALVREEMEKIMSAASSLAGPLLRLHFHDCFVRGCDASVLLNSTDGNTAEKDATPNKSLRGFGSVERVKAKLEAACPNTVSCADVLTLMARDAVVLARGPFWPVALGRRDGRVSSATEAADQLPPAYGDIPLLTKIFASKGLDAKDLVVLSGGHTLGTAHCTSYAGRLYNFSSAYNADPSLDSEYADRLRTRCKSDDDKAMLSEMDPGSYKTFDTSYYRHVAKRRGLFQSDAALLTDATTREYVQRIATGKFDDVFFKDFSESMIKMGSVGVLTGVDGEIRKKCYVAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 1) and 6 ESTs. Cultivar="BTx623".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATTGACTTGGCTAAGATTCATTGCTCCCATGGCTGCCAAGTCTTGTCAAGTGCTACTGCTCCCATTGGTGCTGCTTCTCGCTGGCAGCTCGTTGGCAGTGGCAGATCAGCTGGAA
GTCGGCTACTACAGCAAGACATGCCCGAACGTCGAGGCGCTTGTCCGCGAGGAGATGGAGAAGATCATGTCAGCCGCATCCAGCCTTGCTGGCCCTCTCCTCAGGCTTCACTTCCATGAC
TGCTTCGTGAGG
GTAAGTCAAGCGTGTTTTCTGTTAAATTACAAACATTTTTTGGTTGTTACCCTACAAAGTAGCTTGAACTTGTACACACTCTCATGTTATTGACACGCTGTAGTGGTG
CAGAGCACTGATCAAAACCAATGCATGCTACTCAAATTAAACTGCAGGGTTGTGACGCCTCCGTTCTGCTCAACTCCACCGACGGCAACACGGCAGAGAAGGACGCCACTCCGAACAAGA
GTCTGCGAGGCTTCGGTTCCGTGGAGAGGGTGAAGGCCAAGCTCGAGGCCGCCTGCCCCAACACCGTCTCCTGTGCCGATGTCCTCACGCTCATGGCCCGCGACGCCGTCGTGCTTGCCA
GGGGCCCCTTCTGGCCCGTGGCGCTCGGGAGGCGAGACGGCAGGGTGTCCAGTGCAACTGAGGCGGCCGACCAGCTGCCTCCGGCCTACGGAGACATACCACTGCTCACCAAAATTTTTG
CATCGAAAGGCCTCGATGCAAAGGACCTAGTTGTCCTCTCCGGCGGCCACACCCTCGGCACGGCGCACTGCACGTCTTACGCCGGCCGGCTCTACAACTTCAGTAGCGCCTACAACGCCG
ACCCATCTCTCGACAGCGAGTACGCCGACAGGCTCAGGACGCGCTGCAAGAGCGACGACGACAAGGCCATGCTTTCCGAGATGGACCCCGGCAGCTACAAGACCTTCGACACGAGCTACT
ATCGCCACGTTGCCAAGCGCAGGGGACTGTTCCAGTCCGACGCTGCGCTCCTGACCGATGCAACCACCAGGGAGTACGTCCAGCGCATTGCCACCGGCAAGTTCGACGATGTGTTCTTCA
AGGACTTCAGCGAATCCATGATCAAGATGGGAAGTGTCGGCGTGCTCACCGGTGTTGACGGGGAGATCAGGAAGAAGTGCTACGTTGCTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATTGACTTGGCTAAGATTCATTGCTCCCATGGCTGCCAAGTCTTGTCAAGTGCTACTGCTCCCATTGGTGCTGCTTCTCGCTGGCAGCTCGTTGGCAGTGGCAGATCAGCTGGAA
GTCGGCTACTACAGCAAGACATGCCCGAACGTCGAGGCGCTTGTCCGCGAGGAGATGGAGAAGATCATGTCAGCCGCATCCAGCCTTGCTGGCCCTCTCCTCAGGCTTCACTTCCATGAC
TGCTTCGTGAGG
GGTTGTGACGCCTCCGTTCTGCTCAACTCCACCGACGGCAACACGGCAGAGAAGGACGCCACTCCGAACAAGAGTCTGCGAGGCTTCGGTTCCGTGGAGAGGGTGAAG
GCCAAGCTCGAGGCCGCCTGCCCCAACACCGTCTCCTGTGCCGATGTCCTCACGCTCATGGCCCGCGACGCCGTCGTGCTTGCCAGGGGCCCCTTCTGGCCCGTGGCGCTCGGGAGGCGA
GACGGCAGGGTGTCCAGTGCAACTGAGGCGGCCGACCAGCTGCCTCCGGCCTACGGAGACATACCACTGCTCACCAAAATTTTTGCATCGAAAGGCCTCGATGCAAAGGACCTAGTTGTC
CTCTCCGGCGGCCACACCCTCGGCACGGCGCACTGCACGTCTTACGCCGGCCGGCTCTACAACTTCAGTAGCGCCTACAACGCCGACCCATCTCTCGACAGCGAGTACGCCGACAGGCTC
AGGACGCGCTGCAAGAGCGACGACGACAAGGCCATGCTTTCCGAGATGGACCCCGGCAGCTACAAGACCTTCGACACGAGCTACTATCGCCACGTTGCCAAGCGCAGGGGACTGTTCCAG
TCCGACGCTGCGCTCCTGACCGATGCAACCACCAGGGAGTACGTCCAGCGCATTGCCACCGGCAAGTTCGACGATGTGTTCTTCAAGGACTTCAGCGAATCCATGATCAAGATGGGAAGT
GTCGGCGTGCTCACCGGTGTTGACGGGGAGATCAGGAAGAAGTGCTACGTTGCTAATTAG

Retrieve as FASTA