Entry information : PpePrx22 (ppa008642m)
Entry ID 2786
Creation 2006-01-24 (Christophe Dunand)
Last sequence changes 2011-06-29 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx22 (ppa008642m)
Name (synonym) PpePrx22 (ppa008642m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx22
start..stop
S start..stop
EcamPrx23 507 0 26..324 21..319
EgrPrx23 506 0 26..324 21..319
EguPrx23 504 0 26..324 21..319
EcamPrx22 503 0 28..324 23..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24875554..24875784 231 N° 2 24876534..24876725 192 N° 3 24876814..24876979 166 N° 4 24877076..24877461 386
join(24875554..24875784,24876534..24876725,24876814..24876979,24877076..24877461 )


exon

Literature and cross-references PpePrx22 (ppa008642m)
Literature Abbott,A., Zhebentyayeva,T., Main,D., Jung,S., Staton,M., Jesudurai ,C. and Wing,R. Peach Model Genome for Rosaceae Shoot ESTs. Unpublished (2006).
DNA ref. Phytozome 12:   scaffold_6 (24875554..24877461)
EST ref. GenBank:   DW345343.1 [3' end]
Protein sequence: PpePrx22 (ppa008642m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   33945.98 (30778.3)  
PI (pH):   %s   8.63 (8.39) Peptide Signal:   %s   cut: 31 range:31-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSYHAGSCTATKIKISFSLFLLLVGVASAQLSPTFYSTSCPNALSTIKSAVASAVSSEARMGASLLRLHFHDCFVNGCDASVLLDDTASLTGEKTAGPNANSLRGFDVIDTIKTQLESLCPKVVSCADILTVAARDSIVALGGPTYTVPLGRRDATTASLSAANSNIPGPQLNLAALISAFSNKGFTAREMVALSGSHTIGQARCTTFRNRLYNEANINASFATSVKSQCPSSGGDNTLSPLDVTSPTSFDNAYYRNLVSQKGLLHSDQQLYSGGSTNTIVDAYISNTGTFRADFANAMKKMGNLSPLTGTNGQIRTNCRKIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. Incorrect prediction from phytozome (Extra sequence between 'VALS' and 'GHTI' (splicing error!!!)).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCCTACCATGCAGGCTCATGCACTGCCACAAAAATTAAAATCTCATTTTCATTATTCTTGCTTCTTGTTGGAGTAGCTTCAGCTCAATTGTCCCCTACTTTCTATTCAACATCT
TGCCCCAACGCCCTGTCCACCATAAAATCAGCTGTGGCCTCAGCTGTGTCCAGCGAGGCTCGCATGGGAGCTTCCTTGCTCCGTCTTCATTTCCATGATTGCTTTGTTAAT
GCAAGTCTT
TAATTTCTCCTTTTCCAATTATTTCCCCAATGGGTTCCAATAATATTATTTCCGGTCCTGTGTTTGTTCTAGCTCATGCATTTTCTTATTCCGTACATTTCTAGATTCGCATTTCATGGA
ATTGGTTTTTTTAAGATCTTGATATTTTCGTTTGCTATTGTTGTTATCTAGAATTCTAAAATGAAAGATAATGTTAGATTAATTTAAATTCTAAGTCTTGCGCAATTTGTCTTGTCGACA
TGCAAAACAGTTTGAACCCTCAAACAGCCAAAATATTTGACTTGCTAATTGTGTTCACAAAAGTATTTTTTTATTCTCTATATGTTTTTTTATTCTTTTTCAAGTAATTCATATTTCACC
ATACGACAATCTGCTTTGACCCTTTGTTTCAGTCTTGTCGGTGCACGCGTTGCGAACTACCTAGTGTTGCCCAAGGCTATGCAAACAACTACACGATAAAATAAAAAAATACTGCTAAAG
CTATAGCTAGCTGGAATGAGCACCATGATTGAAAACCCTTTTATTTGTTATATTCGTAAAGCATGTTGGATCCTTCACCGACCAAAAAGAAAAATATTTTGGGTTACTTTTGGGCTCAAT
TACGTGCCTTATTAGCTTTTGCTTTTTGTGCAAAATCTATTTGGTGACAAGCTACGAATCATTCGTGCAAATGTTTTTTTGTTTTTGTTTTTTTGTTACCAGTTCGAATAATTAAGAGAT
GTGAATTTTACGTGAAACAGGGATGTGATGCTTCGGTTCTGTTGGACGACACAGCCAGTTTGACAGGAGAGAAAACGGCAGGTCCCAATGCTAATTCTTTGAGGGGTTTTGATGTCATCG
ACACCATTAAAACCCAATTGGAGAGCCTTTGCCCCAAGGTGGTCTCTTGTGCTGACATCTTGACCGTTGCCGCCAGAGACTCTATTGTTGCA
GTAAGTCAAAATGCTCCAACATAATTTA
TGTCATAATCTGTTCTTTATTTTTATTTTTATGGACTAACTAATTAAATTGTTTAATCAGTTGGGTGGACCGACCTACACAGTGCCATTAGGCAGAAGAGATGCAACCACCGCAAGCTTA
AGTGCTGCCAATTCCAACATACCTGGTCCCCAATTGAACCTGGCTGCCCTCATTTCTGCTTTCTCAAACAAAGGCTTCACCGCCAGGGAAATGGTGGCTCTCTCAG
GTTTACAAATCAAT
TACCAAACATTATAAATTAAGTTCAATTTTTATTATTTGTTTAATATCTAATTACTTTGTTCTTTTTTTCTTGTTTGATTAGGATCTCACACCATTGGCCAAGCTAGGTGCACAACATTT
CGGAATAGACTTTATAACGAAGCCAACATAAACGCGTCATTTGCGACATCCGTGAAATCACAGTGTCCAAGCAGTGGAGGCGACAACACACTTTCCCCACTTGATGTCACAAGCCCAACC
TCTTTCGACAACGCTTACTACAGGAACCTGGTGAGCCAGAAGGGTTTGTTGCACTCAGACCAGCAGCTCTATAGTGGTGGGTCCACCAACACCATAGTCGATGCTTACATCAGCAATACT
GGGACTTTCAGGGCAGATTTTGCCAATGCTATGAAGAAGATGGGAAACCTTAGCCCTCTCACGGGCACCAATGGTCAGATTAGGACCAATTGTAGAAAGATTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCCTACCATGCAGGCTCATGCACTGCCACAAAAATTAAAATCTCATTTTCATTATTCTTGCTTCTTGTTGGAGTAGCTTCAGCTCAATTGTCCCCTACTTTCTATTCAACATCT
TGCCCCAACGCCCTGTCCACCATAAAATCAGCTGTGGCCTCAGCTGTGTCCAGCGAGGCTCGCATGGGAGCTTCCTTGCTCCGTCTTCATTTCCATGATTGCTTTGTTAAT
GGATGTGAT
GCTTCGGTTCTGTTGGACGACACAGCCAGTTTGACAGGAGAGAAAACGGCAGGTCCCAATGCTAATTCTTTGAGGGGTTTTGATGTCATCGACACCATTAAAACCCAATTGGAGAGCCTT
TGCCCCAAGGTGGTCTCTTGTGCTGACATCTTGACCGTTGCCGCCAGAGACTCTATTGTTGCA
TTGGGTGGACCGACCTACACAGTGCCATTAGGCAGAAGAGATGCAACCACCGCAAGC
TTAAGTGCTGCCAATTCCAACATACCTGGTCCCCAATTGAACCTGGCTGCCCTCATTTCTGCTTTCTCAAACAAAGGCTTCACCGCCAGGGAAATGGTGGCTCTCTCAG
GATCTCACACC
ATTGGCCAAGCTAGGTGCACAACATTTCGGAATAGACTTTATAACGAAGCCAACATAAACGCGTCATTTGCGACATCCGTGAAATCACAGTGTCCAAGCAGTGGAGGCGACAACACACTT
TCCCCACTTGATGTCACAAGCCCAACCTCTTTCGACAACGCTTACTACAGGAACCTGGTGAGCCAGAAGGGTTTGTTGCACTCAGACCAGCAGCTCTATAGTGGTGGGTCCACCAACACC
ATAGTCGATGCTTACATCAGCAATACTGGGACTTTCAGGGCAGATTTTGCCAATGCTATGAAGAAGATGGGAAACCTTAGCCCTCTCACGGGCACCAATGGTCAGATTAGGACCAATTGT
AGAAAGATTAACTAG

Retrieve as FASTA