Entry information : PpePrx28 (ppa008808m)
Entry ID 2787
Creation 2006-01-24 (Christophe Dunand)
Last sequence changes 2011-06-29 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx28 (ppa008808m)
Name (synonym) PpePrx28 (ppa008808m)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type Shoots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx28
start..stop
S start..stop
EcamPrx191 500 0 1..318 1..317
EguPrx191 498 1e-179 1..318 1..317
VvPrx20 496 3e-179 1..318 1..317
EgrPrx191 496 4e-179 1..318 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8878003..8878218 216 N° 2 8877585..8877776 192 N° 3 8876187..8876735 549  
complement(join(8876187..8876735,8877585..8877776,8878003..8878218))


exon

Literature and cross-references PpePrx28 (ppa008808m)
Literature Abbott,A., Zhebentyayeva,T., Main,D., Jung,S., Staton,M., Jesudurai,C. and Wing,R. Peach Model Genome for Rosaceae Shoot ESTs. Unpublished (2006).
DNA ref. Phytozome 12:   scaffold_3 (8878218..8876187)
EST ref. GenBank:   DW344041.1
Protein sequence: PpePrx28 (ppa008808m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (293)
PWM (Da):   %s   34043.06 (31279.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.32 (8.40) Peptide Signal:   %s   cut: 26 range:26-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLSYSFIVVTLFIIPFFGCGANAQLSPNFYARTCPSLPTIVRNAMSQAVTREARMGASILRLFFHDCFVNGCDASILLDDTATFTGEKNAFPNQNSVRGFEVIDTIKTRVEAACNATVSCADILALATRDGVVLLGGTSWTVALGRRDARTASQSDANNQLPSPFANLATLISSFAAKGLTASDLTVLSGGHTIGQSQCLLFKTRIYNETNIDPSFATTRKATCPASGGDTNLAPFDITPTRFDNNYYKALVARRGLLHSDQELFNSGSQDALVRTYSNNAAAFSRDFAAAMAKMSAISPLTGTNGEIRKNCRLVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTCTGTCCTACTCCTTCATTGTTGTTACACTCTTCATCATCCCTTTTTTTGGTTGTGGTGCCAATGCACAACTCTCTCCCAACTTCTATGCAAGAACCTGCCCAAGTCTTCCG
ACCATCGTTCGCAATGCTATGAGTCAGGCTGTTACTAGGGAGGCTCGGATGGGTGCCTCGATCCTTCGCTTATTCTTCCACGACTGCTTTGTAAAT
GTGAGAACAATACAGTAGTGTTTT
CTTATATCGAACAATCTGATGTGTTATCGTAGACAAAGATTGTTAATTATATGTGGAATCATGTTTAAATATATTGGCAAAGAGAAAGGGGTCTCATTTTAATTTACGTCCCTGAGTCAC
CCAAAAGTCAGGAACGGCCCTAACTCGACTGTGTCCCATTACCATTTCAATTGTCTAATACTAATATGTTGTTTTTCAATAGGGTTGCGACGCTTCCATACTATTGGATGACACGGCCAC
CTTCACCGGTGAAAAGAATGCATTCCCAAACCAGAACTCAGTCAGGGGATTTGAAGTCATTGACACCATCAAAACCCGAGTGGAAGCTGCTTGTAATGCTACTGTATCTTGTGCAGATAT
TTTAGCACTCGCAACCCGGGATGGAGTTGTCTTG
GTTAGTAGCTACCTACTATATTAATTTGACGTAATAGGCTACTGATATGCATCTTGTGAAGCATCAAGCTTTTCCATGGATATTAA
TTAATTTACCATAAAATTTTGCCATATTTTGGGGTAGATTGGTTTTCAAGCTATGGTACAATCATTTCCTATTATTTTTGGTCCTAACAATTTAATTTCCTATTATTTTTAAGAAAACAT
CTCACTTGGGAGTAGTCCTAATTTCTTTTGTCGACATTAATTTGGAGTTGAATTATGTTGTGCATGTCAAATTCTCAATCTAATACATAAATTTTAGATCTCAATTTATTATTATTTTCT
CTGTTTGGACAAGCGTTATTTTTTCAACTATGGTCCTGACGACTTACGACTTTCTAAGTGATTATAGAATATTAAGGTAGTACGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTATTATATAATTTCTC
TGACTTTCATGGTGTCTGGTCTGATTTTGCTGCATGCCAACTCAACAACCTGCATGGGGACAAAACCTAACCTGCTACGTACATATTTTAAAATATCAGATTAGTCAATGATTGAATTTT
AACCCATTTTAAAATTTGCATGGACATAAGCCCTCTACGACCCAATCCACATACCAAGATATCATACATATTCTATCCATTTATAGGAAAAGACCTCTTTTGCTTTTTCTTTTGTTTTGA
TCACGTGATATTCACATGCTCAATACTTTGTTTCTTTGTGCAGCTTGGAGGAACCTCATGGACGGTAGCCCTAGGCCGAAGAGATGCAAGAACTGCAAGCCAAAGCGATGCCAACAACCA
ACTCCCCTCCCCCTTCGCCAACCTCGCAACCCTAATCTCGAGTTTCGCAGCGAAAGGCTTAACCGCCAGCGATCTGACCGTGCTCTCCGGTGGCCACACAATAGGCCAGTCTCAGTGTCT
TCTATTCAAAACCCGCATATACAACGAGACCAACATTGACCCCAGCTTTGCCACCACTCGTAAGGCTACATGTCCGGCTTCCGGCGGCGATACAAATCTTGCTCCCTTCGATATAACCCC
GACTCGTTTCGATAATAATTACTACAAGGCCCTTGTGGCTCGTCGTGGTCTTCTTCATTCCGATCAGGAGCTCTTCAACAGCGGGAGTCAGGATGCCTTGGTTAGAACGTATAGTAACAA
CGCCGCCGCGTTTTCAAGAGATTTTGCTGCAGCCATGGCGAAGATGAGCGCTATTAGTCCTCTAACTGGGACAAATGGAGAGATCAGGAAGAATTGCAGATTAGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTCTGTCCTACTCCTTCATTGTTGTTACACTCTTCATCATCCCTTTTTTTGGTTGTGGTGCCAATGCACAACTCTCTCCCAACTTCTATGCAAGAACCTGCCCAAGTCTTCCG
ACCATCGTTCGCAATGCTATGAGTCAGGCTGTTACTAGGGAGGCTCGGATGGGTGCCTCGATCCTTCGCTTATTCTTCCACGACTGCTTTGTAAAT
GGTTGCGACGCTTCCATACTATTG
GATGACACGGCCACCTTCACCGGTGAAAAGAATGCATTCCCAAACCAGAACTCAGTCAGGGGATTTGAAGTCATTGACACCATCAAAACCCGAGTGGAAGCTGCTTGTAATGCTACTGTA
TCTTGTGCAGATATTTTAGCACTCGCAACCCGGGATGGAGTTGTCTTG
CTTGGAGGAACCTCATGGACGGTAGCCCTAGGCCGAAGAGATGCAAGAACTGCAAGCCAAAGCGATGCCAAC
AACCAACTCCCCTCCCCCTTCGCCAACCTCGCAACCCTAATCTCGAGTTTCGCAGCGAAAGGCTTAACCGCCAGCGATCTGACCGTGCTCTCCGGTGGCCACACAATAGGCCAGTCTCAG
TGTCTTCTATTCAAAACCCGCATATACAACGAGACCAACATTGACCCCAGCTTTGCCACCACTCGTAAGGCTACATGTCCGGCTTCCGGCGGCGATACAAATCTTGCTCCCTTCGATATA
ACCCCGACTCGTTTCGATAATAATTACTACAAGGCCCTTGTGGCTCGTCGTGGTCTTCTTCATTCCGATCAGGAGCTCTTCAACAGCGGGAGTCAGGATGCCTTGGTTAGAACGTATAGT
AACAACGCCGCCGCGTTTTCAAGAGATTTTGCTGCAGCCATGGCGAAGATGAGCGCTATTAGTCCTCTAACTGGGACAAATGGAGAGATCAGGAAGAATTGCAGATTAGTGAACTAA

Retrieve as FASTA