Entry information : MtPrx86 (Medtr5g074710.1[4.0] / Medtr5g074710.1[3.5] / Medtr5g082680.1[3.0])
Entry ID 2795
Creation 2006-06-22 (Christophe Dunand)
Last sequence changes 2006-06-22 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx86 (Medtr5g074710.1[4.0] / Medtr5g074710.1[3.5] / Medtr5g082680.1[3.0])
Name (synonym) MtPrx86 (Medtr5g074710.1[4.0] / Medtr5g074710.1[3.5] / Medtr5g082680.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Seedling roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx86
start..stop
S start..stop
MtPrx70 605 0 1..322 1..322
MtPrx02 603 0 1..323 1..323
GmPrx40 502 0 1..321 1..329
LjPrx19 499 3e-180 1..321 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31754569..31754778 210 N° 2 31753896..31754090 195 N° 3 31752958..31753524 567  
complement(join(31752958..31753524,31753896..31754090,31754569..31754778))


exon

Literature and cross-references MtPrx86 (Medtr5g074710.1[4.0] / Medtr5g074710.1[3.5] / Medtr5g082680.1[3.0])
Literature Shaull,S., Lin,S., Dixon,R., May,G., Sumner,L., Gonzales,B., Cook,D., Kim,D. and Roe,B.A. Medicago truncatula BAC Clone mth1-31p6, Unpublished.
Protein ref. UniProtKB_Uniparc:   Q1T3V7
DNA ref. Phytozome 11:   chr5 (31754778..31752958)
EST ref. GenBank:   AW256603
Cluster/Prediction ref. Phytozome Gene 11:   31091118
Omic ref. Gene atlas:   Mtr.14635.1.S1_at
Protein sequence: MtPrx86 (Medtr5g074710.1[4.0] / Medtr5g074710.1[3.5] / Medtr5g082680.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35730.48 (33181.1)  
PI (pH):   %s   9.55 (9.41) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSRIQIVFFVVTFATILSPTIAKLSSNYYDEICPQALPIIKSVVKQAIIREPRMGASLLRLHFHDCFVNGCDGSILLDDTPTFIGEKTAIPNINSLRGFEVVDQIKAAVDKACKRPIISCADILAIAARDSVAILGGHKYWYQVLLGRRDSRFASRDAANINLPPAFFNFSQLIANFQSQGLNLKDLVVLSGGHTIGFSRCTNFRSRIFNDTNINTNFAANLQKTCPRIGGDDNLAPFDSTPSRVDTKYYKALLHKKGLLHSDQELFKGDGSQSDRLVQLYSKHSHAFAYDFGVSMIKMGNIKPLTGKNGEIRCNCRKVNQI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, introns 1 and 2) and 1 EST. AC123575 contains 4 peroxidases (MtPrx01, 02, 70, 86) and one pseudogene.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTCTCGTATCCAAATTGTGTTTTTTGTGGTCACTTTTGCAACAATTTTGAGTCCTACCATTGCAAAACTGTCTTCTAATTATTATGACGAAATTTGCCCACAGGCATTGCCAATC
ATAAAGTCGGTTGTTAAGCAAGCAATTATTCGTGAGCCACGCATGGGAGCATCGTTGCTACGTTTGCATTTCCATGACTGCTTTGTTAAC
GTGAGTTAATTGCATAAATTCGCGATACAT
TTTCTAGTATCATTAAATAGAATCCATGTACATTTTTTATAGCTAAAAATGTTAGTAAGTTGATGTTTATGTTAATTTTCGGTGTTTGAACTTTGTCCTTCACATTTCTTAGTTCATCAA
CCAAATTACACGCGTGACACAGACAGATTCATTGTTCTCTTGTTTTTGTGCATCACAATTTTGACAACGCATATTATTGAAAAGAAAGTTGAATTGTCGCCGGAAAAATAAATTAGGTTT
CTGATTTTTGCACTTCTAGCCCTTACAAGTGGATTTCATGTAGTACTCATGCTAAATATTGTTCCTTTTTATTCAAAATTTGTATTTCTATATTAATTTCAAACTTATTTTGAGTTCAAT
TATAGTTGAATCATATTCATGTCACATTTACATATGAATAATTTCCATTATAGTATAACTAATACCTGAACTATATGAAACTACATAGGGTTGTGATGGATCAATTCTACTAGATGACAC
CCCTACCTTCATTGGTGAGAAGACTGCAATTCCAAATATCAATTCACTTAGAGGTTTTGAGGTTGTTGATCAAATTAAAGCCGCAGTTGACAAAGCTTGTAAACGTCCGATCATATCATG
TGCAGATATCTTAGCTATAGCAGCTCGAGATTCTGTTGCCATA
GTAAGTATTTCCAATATGTTGCAACTATAATTTTGACCGCACTTTATCACAATATAAAAGTTTACACCCTAATCGCA
ACAACTAAACCGGCATTTAAAATCATGCTTGTAGTTCTTAATAATTAGGTTTATAGTTATTGTCATCCTTATGTCGCAATTCTTGATATTGCAAAAACTTCGAGAGAAGTGTAGTTATGG
TTGCAAGACTATAATTCCTTAAATTGTATAGAAGAAATCTAATGACCAACTGAAATTAGTCTTTTGTTTTGCTCGTTATAAAATTTATCGACAAAATTAGAGATATATTTCTAATTTTAA
AGACTTAGTTGTTCTATAACACTGACAACTAACAAATTTTGCATCAATTAACAGTTGGGCGGTCACAAATATTGGTACCAAGTGTTACTGGGCAGAAGAGATTCAAGATTTGCAAGCAGA
GATGCAGCAAATATAAATCTTCCACCGGCATTTTTTAACTTCTCACAACTCATCGCAAATTTTCAGTCTCAAGGACTAAACCTTAAAGACTTAGTTGTTCTATCTGGTGGTCACACAATT
GGATTTTCAAGATGTACTAACTTTAGAAGCAGGATCTTCAATGACACCAACATAAACACCAATTTTGCAGCCAATTTGCAAAAGACATGCCCTAGAATTGGCGGCGATGACAATTTAGCA
CCATTTGATTCTACTCCTTCAAGAGTTGACACAAAATACTATAAGGCTTTGTTGCATAAAAAGGGTCTCCTTCATTCTGATCAAGAGCTTTTCAAAGGTGATGGTTCTCAAAGTGATAGA
TTGGTGCAACTTTATAGTAAACATTCTCATGCTTTTGCTTATGATTTTGGAGTTTCTATGATTAAGATGGGTAACATAAAGCCACTTACTGGGAAAAATGGTGAGATCAGGTGCAATTGC
AGGAAAGTTAACCAAATATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTCTCGTATCCAAATTGTGTTTTTTGTGGTCACTTTTGCAACAATTTTGAGTCCTACCATTGCAAAACTGTCTTCTAATTATTATGACGAAATTTGCCCACAGGCATTGCCAATC
ATAAAGTCGGTTGTTAAGCAAGCAATTATTCGTGAGCCACGCATGGGAGCATCGTTGCTACGTTTGCATTTCCATGACTGCTTTGTTAAC
GGTTGTGATGGATCAATTCTACTAGATGAC
ACCCCTACCTTCATTGGTGAGAAGACTGCAATTCCAAATATCAATTCACTTAGAGGTTTTGAGGTTGTTGATCAAATTAAAGCCGCAGTTGACAAAGCTTGTAAACGTCCGATCATATCA
TGTGCAGATATCTTAGCTATAGCAGCTCGAGATTCTGTTGCCATA
TTGGGCGGTCACAAATATTGGTACCAAGTGTTACTGGGCAGAAGAGATTCAAGATTTGCAAGCAGAGATGCAGCA
AATATAAATCTTCCACCGGCATTTTTTAACTTCTCACAACTCATCGCAAATTTTCAGTCTCAAGGACTAAACCTTAAAGACTTAGTTGTTCTATCTGGTGGTCACACAATTGGATTTTCA
AGATGTACTAACTTTAGAAGCAGGATCTTCAATGACACCAACATAAACACCAATTTTGCAGCCAATTTGCAAAAGACATGCCCTAGAATTGGCGGCGATGACAATTTAGCACCATTTGAT
TCTACTCCTTCAAGAGTTGACACAAAATACTATAAGGCTTTGTTGCATAAAAAGGGTCTCCTTCATTCTGATCAAGAGCTTTTCAAAGGTGATGGTTCTCAAAGTGATAGATTGGTGCAA
CTTTATAGTAAACATTCTCATGCTTTTGCTTATGATTTTGGAGTTTCTATGATTAAGATGGGTAACATAAAGCCACTTACTGGGAAAAATGGTGAGATCAGGTGCAATTGCAGGAAAGTT
AACCAAATATGA

Retrieve as FASTA