Entry information : MtPrx89 (Medtr7g086820.1[4.0]Medtr7g103630.1[3.0])
Entry ID 2798
Creation 2006-01-30 (Christophe Dunand)
Last sequence changes 2006-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx89 (Medtr7g086820.1[4.0]Medtr7g103630.1[3.0])
Name (synonym) MtPrx89 (Medtr7g086820.1[4.0]Medtr7g103630.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx89
start..stop
S start..stop
MtPrx[P]116 498 6e-180 5..315 1..310
GmPrx125 473 4e-170 3..313 2..311
PvPrx13 447 9e-160 1..315 1..314
PtPrx38 413 5e-146 5..315 4..310
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33764725..33764919 195 N° 2 33763582..33764334 753  
complement(join(33763582..33764334,33764725..33764919))


exon

Literature and cross-references MtPrx89 (Medtr7g086820.1[4.0]Medtr7g103630.1[3.0])
Literature Town,C.D., Tallon,L.J., Arbogast,T., Althoff,R., Hine,E.,Monaghan,E., Smith,S.A., Utterback,T., Feldblyum,T., Koo,H. and Cheung,F. Medicago truncatula BAC genomic sequence, Unpublished.
DNA ref. Phytozome 12:   chr7 (33764919..33763582)
Cluster/Prediction ref. Phytozome Gene 12:   31082181
Omic ref. Gene atlas:   Mtr.22812.1.S1_at
Protein sequence: MtPrx89 (Medtr7g086820.1[4.0]Medtr7g103630.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (297)
PWM (Da):   %s   34144.54 (32051.3) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.2 (7.98) Peptide Signal:   %s   cut: 19 range:19-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQISIIIFFFILPLAFADLELGFYASSCRKAESIVKQVVQKRFNRDKSITAALLRMHFHDCFVRGCDASLLIDSTKNNISEKDTGANDSVRGYDLIDDVKEAIEAACPSTVSCADIVALATRDAVALSGGPKYNIPTGRRDGLIANRDDVDLPGPNIPIGALSQFFAAKGITTEEMVTLLGAHTVGVAHCGFFASRLSSVRGKPDPTMDPALDTKLVKLCKSNSDGAAFLDQNTSFTVDNEFYKQILLKRGIMQIDQQLALDKSTSTFVSNFASNGDKFVKSFATAMIKMGKVGVLVGNEGEIRKNCRVFNKRN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 7, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGATATCAATCATCATCTTTTTCTTTATACTTCCCTTGGCATTTGCAGATCTAGAATTAGGGTTCTATGCCTCTTCCTGCCGAAAAGCCGAGTCCATTGTTAAACAAGTTGTG
CAGAAGCGATTCAATCGCGACAAATCCATAACCGCAGCTTTGCTTCGTATGCATTTCCATGACTGTTTTGTCAGA
GTAAGAACTATCTAGCTAAATATGTTCTAAGTGTTAGTTTGATAA
AAAAAAAATCCATTTGAAGTTTTAACAGTTATATGAAAGTTAGATGAAAAAAGTTGGTTAACATATTGAGGTAAAAAAGCTTATTATAATTTATTAATTTTTTAAAAAACAATGATAGCT
TCGCTCCTCTCTTGCATCTGCAATAAGGGGTTGACCGTTGTTATCCATCAACTAAAAGATCAATACTCAACGGCCAACCACTGACTGCAGAGACGAGACAAGAGAAGACCAATTATTTTG
ATTTTATTTTTCTATAGTATAATTATTGAAAAGTTTATTAAGTTAGCTCTAGGCGGCCATTCTCAACTACATCGATTCATAACATACATTTTCATCCATGTGCAGGGTTGTGATGCATCC
CTCCTCATAGATTCAACCAAGAACAACATATCAGAAAAAGATACAGGCGCAAATGACAGTGTTAGAGGCTACGATCTAATTGACGATGTAAAGGAAGCAATTGAAGCTGCATGTCCATCA
ACGGTTTCATGTGCAGACATCGTAGCACTTGCTACAAGAGATGCTGTGGCCTTATCTGGAGGACCAAAATACAATATTCCTACAGGAAGACGTGACGGATTAATCGCCAATAGGGATGAC
GTTGATTTACCAGGACCTAACATTCCTATAGGAGCACTATCACAATTTTTTGCTGCAAAAGGAATTACAACAGAAGAAATGGTGACCCTTTTGGGAGCACATACTGTTGGTGTTGCACAT
TGCGGTTTTTTCGCAAGTAGGTTATCTAGTGTTAGAGGGAAACCTGATCCTACAATGGACCCTGCATTGGATACTAAGCTTGTGAAGTTGTGCAAATCAAATAGTGATGGTGCTGCATTT
TTGGATCAGAATACTTCTTTTACTGTTGATAATGAATTTTACAAGCAGATTCTTCTTAAGAGAGGTATAATGCAGATTGATCAGCAACTTGCTTTGGATAAATCAACAAGTACTTTTGTG
TCTAATTTTGCTTCAAATGGTGATAAGTTTGTTAAGAGTTTCGCAACCGCTATGATAAAGATGGGGAAAGTTGGAGTTTTGGTTGGAAATGAAGGAGAAATCCGCAAGAATTGCAGGGTT
TTCAACAAACGCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGATATCAATCATCATCTTTTTCTTTATACTTCCCTTGGCATTTGCAGATCTAGAATTAGGGTTCTATGCCTCTTCCTGCCGAAAAGCCGAGTCCATTGTTAAACAAGTTGTG
CAGAAGCGATTCAATCGCGACAAATCCATAACCGCAGCTTTGCTTCGTATGCATTTCCATGACTGTTTTGTCAGA
GGTTGTGATGCATCCCTCCTCATAGATTCAACCAAGAACAACATA
TCAGAAAAAGATACAGGCGCAAATGACAGTGTTAGAGGCTACGATCTAATTGACGATGTAAAGGAAGCAATTGAAGCTGCATGTCCATCAACGGTTTCATGTGCAGACATCGTAGCACTT
GCTACAAGAGATGCTGTGGCCTTATCTGGAGGACCAAAATACAATATTCCTACAGGAAGACGTGACGGATTAATCGCCAATAGGGATGACGTTGATTTACCAGGACCTAACATTCCTATA
GGAGCACTATCACAATTTTTTGCTGCAAAAGGAATTACAACAGAAGAAATGGTGACCCTTTTGGGAGCACATACTGTTGGTGTTGCACATTGCGGTTTTTTCGCAAGTAGGTTATCTAGT
GTTAGAGGGAAACCTGATCCTACAATGGACCCTGCATTGGATACTAAGCTTGTGAAGTTGTGCAAATCAAATAGTGATGGTGCTGCATTTTTGGATCAGAATACTTCTTTTACTGTTGAT
AATGAATTTTACAAGCAGATTCTTCTTAAGAGAGGTATAATGCAGATTGATCAGCAACTTGCTTTGGATAAATCAACAAGTACTTTTGTGTCTAATTTTGCTTCAAATGGTGATAAGTTT
GTTAAGAGTTTCGCAACCGCTATGATAAAGATGGGGAAAGTTGGAGTTTTGGTTGGAAATGAAGGAGAAATCCGCAAGAATTGCAGGGTTTTCAACAAACGCAATTAG

Retrieve as FASTA