Entry information : CreAPx01 (Cre05.g233900.t1.1)
Entry ID 2805
Creation 2006-02-03 (Christophe Dunand)
Last sequence changes 2006-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: CreAPx01 (Cre05.g233900.t1.1)
Name (synonym) CreAPx01 (Cre05.g233900.t1.1)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Chlorophyta Chlorophyceae Chlamydomonadaceae Chlamydomonas
Organism Chlamydomonas reinhardtii    [TaxId: 3055 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CreAPx01
start..stop
S start..stop
VcaAPx01 404 2e-141 2..347 3..360
OCgAPx01 221 4e-71 68..338 1..270
AacAPx01 171 9e-52 34..284 1..245
CirAPx02 114 6e-30 45..329 15..272
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 801485..801611 127 N° 2 801057..801211 155 N° 3 800766..800878 113 N° 4 800595..800655 61
N° 5 800350..800433 84 N° 6 799873..800055 183 N° 7 799408..799586 179 N° 8 799062..799203 142
complement(join(799062..799203,799408..799586,799873..800055,800350..800433,8005 95..800655,800766..800878,801057..801211,801485..801611))


exon

Literature and cross-references CreAPx01 (Cre05.g233900.t1.1)
Literature JGI genome version 3
DNA ref. Phytozome 12:   chromosome_5 (801611..799062)
Cluster/Prediction ref. UniGene:   Cre.2604
Protein sequence: CreAPx01 (Cre05.g233900.t1.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347
PWM (Da):   %s   36322.24  
PI (pH):   %s   9.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQVAFKSSSTVQRSGARSSTRRSVLRVVAQAGPVSRRDLLSVALVAGAAPLVLGAQPASAAPLPVTQMPVEQLGLLQKQAQLKEFRTRAEAAIEVVTTEDGPLCVRLVLNDAADWDPVTKTGGVNGSIVTPEALARPENAGLEVVVAKLAAKAKIDAAGAEDGAGPISWADLIVLAAKVTTQSGWSATKVSRAQIASGGEVIAGPAFSAAWPVRLGRVDSPAAAAVKVPTYDSPVAEIKAFAATLGAKPGASSGFLAAKPPIWERPAFVLWTAGAANPAVEEARWVSEDPATFKSVKEMYDRSRRTVTRTDYEVDFVDYFTLLTSFATFKPDAYLHPEAVTAIRF

Retrieve as FASTA  
Remarks Complete sequence from genomic and at least 14 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGTCGCTTTTAAGTCATCGAGCACGGTGCAGCGCTCGGGCGCGCGGTCGAGCACCCGGCGCTCCGTCCTGCGCGTTGTTGCGCAAGCGGGCCCTGTTTCTCGCCGCGACCTGCTG
AGCGTTG
GTGAGCTGCGACTATCAACAGTGGATGGCATCATGTGTCTCGACCTAGATTTGGGGTGAAGTCAGGGCAATGCGTTAGATTCGGAGCGGAGGCCACGGACATCGGCATCGATC
ATCCTCTCCCCACTCGCTGCGTGTCGCCAGGCGCCAGCTTCGGCACGTAGTACGTCAGCGTTATATGATGCACCCCATCCAGCTGCGACACCCGATCTCGATGATTATCAGGGCCGAGCC
GGTTAACCAACCTGCGAACTTGTGCCCTCTCCGGCTGCAGCCCTGGTCGCTGGTGCCGCCCCACTGGTGCTGGGCGCCCAGCCCGCCTCCGCCGCTCCGCTGCCGGTGACCCAGATGCCT
GTGGAGCAGCTGGGCCTGCTGCAGAAGCAGGCGCAGCTCAAGGAGTTCCGCACCCGTGCGGAGGCCGCTATCAAG
GTGCGAGGGGCGAATGCGGAGCTGTTGTTGGGGCCGGGATGTAGA
GCGGGACGCTGCAAGTTGCAAGGAGCGGATCCGCCATCGGCAGGTTTTAGCAGCATGGAGTCAAACAAACACTTTGTTTGCTGTGAGGCAATCGGTCTGATTACCCCCAGCCAACGTGCT
TCTGCCACCGCAGGAGGTTGTGACCACCGAGGACGGCCCCCTCTGTGTGCGCCTGGTGCTCAACGACGCCGCGGACTGGGACCCCGTGACCAAGACTGGCGGCGTCAACGGCTCCATCGT
GACCCC
GTGAGTGCTTGGCTTCGCAACCCAGTCGTGTAATGATGTGCGGTCCCTTGGTGTCGTCTGCTTTCCTGTAACGCTCTTTGCGCCGCTTTCCCGTTCGACTGCGTCTGCAGTGAG
GCGCTGGCCCGCCCCGAGAACGCCGGCCTGGAGGTGGTGGTGGCCAAGCTGGCCAAG
GTGTGCACGGACGGACGCTGACGGGGTGGGGCCGCCTTGGTGAAGGCAGGGTGACACGGAGGA
ATTACCTTGATCGGGAACAGAACACTGGGCTGACCGGCAACATTGCAGCGCAGCTGACGTGGCATATCTCGTCTACCCCTCTATCCCCGCACCGGCAGGCCAAGGCCAAGATCGACGCCG
CCGGCGCCGAGGACGGCGCCGGCCCCATCTCCTGGGCGGACCTGATCGTGCTGGCGGCCAAG
GTGGGTGGGTAATGTGGGTGGGTGGGCAGGGGGACGTCCCAGCCGGGGGAAAGGGGAT
GACGCTAGGTAGGCAGGAAGGGCACAAGAAGCGGCGCGCGTCATAATGCCCAATTCTGTGTTATGCTGTGGGGCGCGGGATTTGTCGACTCTAAAACGTAGAGCGACTTGTGGTGACAAA
GGTAGGCTGGGACTGTCTGATACTACTACGGTACCTAAGTCGCTTGCGGTTAGACGTATCGTGCTTTAAGCCCTCGTCATGTCAGCAGCATGCTGTGCTGCTATCCCCCATTGCAGGTGA
CTACCCAGTCCGGCTGGTCTGCCACCAAGGTGTCTCGCGCTCAGATTGCTAGCGGCGGCGAGGTGATTGCCGGGCCCGCCTTCTCGGCTGCCTGGCCTGTGCGCCTGGGCCGTGTGGACA
GCCCCGCGGCCGCGGCCGTCAAGGTGCCCACCTACGACTCGCCCGTGGCGGAGATCAAG
GTGCCATGAGGAGGGCGGGGCTGGGAGGGGGGGTGTACGACCATTCCCACCGATGAGGTCG
AGGGAAAACAGATACACACGACTGTAGTGGGGGCTTACTGGGTGCGCGATGGAGGTTGGGGCCGAAAGCAGCCGTGTGCCCTGGGCGAACTTGCTTTTTGGTGCCAGGCAATATGCAACG
TCCTGCGCCTTCCGCACACCTCGACCTCATGTACACAGCTCCCCTGCCTCGTCCTGCCCCTGCCGCCTCGCCCCACCTTCCCCCATCTGCTTATCACCCGCTCAGGCCTTCGCTGCCACC
CTGGGCGCTAAGCCCGGTGCCAGCAGCGGCTTCCTGGCCGCCAAGCCGCCGATTTGGGAGCGCCCCGCCTTCGTGCTGTGGACCGCTGGCGCCGCCAACCCGGCTGTGGAGGAGGCGCGC
TGGGTGAGCGAGGACCCCGCCACCTTCAAGAGCGTCAAGGAGAT
GTGAGACTACAGGGGGCGGGATGGGGGGAGGAGAGTCAGATTTACGCGGGAACGCAGAGTATGGATTGGGCTGTGG
CACAAATCGAAGTGGTACCGCTTTCAACCGTTCGGGCCACTGCTGACGGCTTCTATATTGCCAAACCCATAAGACACGACCTCTTGCGATGGCCGCGGCCCCTCCTGCCTCCTGCCTCAC
CTCCCCAGGTACGACCGCTCCCGGCGCACCGTGACCCGCACTGACTACGAGGTGGACTTCGTGGACTACTTCACGCTGCTCACTTCCTTCGCCACCTTCAAGCCCGACGCCTACCTGCAC
CCCGAGGCCGTGACCGCCATCCGGTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGTCGCTTTTAAGTCATCGAGCACGGTGCAGCGCTCGGGCGCGCGGTCGAGCACCCGGCGCTCCGTCCTGCGCGTTGTTGCGCAAGCGGGCCCTGTTTCTCGCCGCGACCTGCTG
AGCGTTG
CCCTGGTCGCTGGTGCCGCCCCACTGGTGCTGGGCGCCCAGCCCGCCTCCGCCGCTCCGCTGCCGGTGACCCAGATGCCTGTGGAGCAGCTGGGCCTGCTGCAGAAGCAGGCG
CAGCTCAAGGAGTTCCGCACCCGTGCGGAGGCCGCTATCAAG
GAGGTTGTGACCACCGAGGACGGCCCCCTCTGTGTGCGCCTGGTGCTCAACGACGCCGCGGACTGGGACCCCGTGACC
AAGACTGGCGGCGTCAACGGCTCCATCGTGACCCC
TGAGGCGCTGGCCCGCCCCGAGAACGCCGGCCTGGAGGTGGTGGTGGCCAAGCTGGCCAAGGCCAAGGCCAAGATCGACGCCGCC
GGCGCCGAGGACGGCGCCGGCCCCATCTCCTGGGCGGACCTGATCGTGCTGGCGGCCAAG
GTGACTACCCAGTCCGGCTGGTCTGCCACCAAGGTGTCTCGCGCTCAGATTGCTAGCGGC
GGCGAGGTGATTGCCGGGCCCGCCTTCTCGGCTGCCTGGCCTGTGCGCCTGGGCCGTGTGGACAGCCCCGCGGCCGCGGCCGTCAAGGTGCCCACCTACGACTCGCCCGTGGCGGAGATC
AAG
GCCTTCGCTGCCACCCTGGGCGCTAAGCCCGGTGCCAGCAGCGGCTTCCTGGCCGCCAAGCCGCCGATTTGGGAGCGCCCCGCCTTCGTGCTGTGGACCGCTGGCGCCGCCAACCCG
GCTGTGGAGGAGGCGCGCTGGGTGAGCGAGGACCCCGCCACCTTCAAGAGCGTCAAGGAGAT
GTACGACCGCTCCCGGCGCACCGTGACCCGCACTGACTACGAGGTGGACTTCGTGGAC
TACTTCACGCTGCTCACTTCCTTCGCCACCTTCAAGCCCGACGCCTACCTGCACCCCGAGGCCGTGACCGCCATCCGGTTCTAA

Retrieve as FASTA