Entry information : MtPrx92 (Medtr8g075100.1[4.0] / Medtr8g075100.1[3.5] / Medtr8g089290.1[3.0])
Entry ID 2812
Creation 2006-02-17 (Christophe Dunand)
Last sequence changes 2006-02-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx92 (Medtr8g075100.1[4.0] / Medtr8g075100.1[3.5] / Medtr8g089290.1[3.0])
Name (synonym) MtPrx92 (Medtr8g075100.1[4.0] / Medtr8g075100.1[3.5] / Medtr8g089290.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots nodules
Inducers Nodulation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx92
start..stop
S start..stop
LjPrx29 566 0 1..319 1..316
GmPrx06 547 0 5..319 3..316
GmPrx88 543 0 5..319 3..317
MtPrx08 533 0 5..319 3..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31747632..31747844 213 N° 2 31748025..31748213 189 N° 3 31748628..31748790 163 N° 4 31749532..31749926 395
join(31747632..31747844,31748025..31748213,31748628..31748790,31749532..31749926 )


exon

Literature and cross-references MtPrx92 (Medtr8g075100.1[4.0] / Medtr8g075100.1[3.5] / Medtr8g089290.1[3.0])
Literature Journet,E.P., Crespeau,H., van-Tuinen,D., Gouzy,J., Jaillon,O., Niebel,A., Carreau,V., Chatagnier,O., Kahn,D., Gianinazzi-Pearson,V. and Gamas,P. Medicago truncatula ESTs from Sinorhizobium meliloti-induced root nodules
DNA ref. Phytozome 11:   chr8 (31747632..31749926)
Cluster/Prediction ref. Phytozome Gene 11:   31071726 UniGene:   Mtr.18263
Omic ref. Gene atlas:   Mtr.4733.1.S1_at   Mtr.4733.1.S1_s_at   Mtr.51876.1.S1_at
Protein sequence: MtPrx92 (Medtr8g075100.1[4.0] / Medtr8g075100.1[3.5] / Medtr8g089290.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   34627.64 (31949.2) Transmb domain:   %s   o5-27i
PI (pH):   %s   8.72 (8.72) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAINIMVTLFLSLILLFSIVSTGNSLSYNYYEKTCPDVEFIVAKTVKAATASDKTVPAALLRMHFHDCFIRGCDASVLLNSKGSNKAEKDGPPNASLHAFFIIDNAKKALEAACPGVVSCADILAFAARDAVFLSGGPSWDIPKGRKDGRISKASETIQLPSPSFNISQLQKSFSQRGLSMEDLVALSGGHTLGFSHCSSFRNRIHNFDATHDVDPSLNPSFASKLKSICPIINQVKNAGTTLDASSTTFDNTYYKLILQRKGIFSSDQVLIDTPYTKDLVSKFATSQDEFYKAFVKSMVKMSSINGGQEIRKDCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 3 introns) and 3 ESTs (AL378592, AL378591, AL378589).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCAATATCATGGTTACATTATTCTTGAGTTTAATTCTCTTGTTTTCAATAGTTTCAACAGGGAATTCACTTAGTTACAACTACTATGAAAAGACATGCCCTGATGTAGAGTTT
ATTGTTGCCAAGACAGTTAAAGCTGCCACTGCTTCAGACAAAACTGTCCCTGCAGCGCTTCTCCGAATGCACTTCCATGACTGCTTCATTCGG
GTAATACTAAAAAAAACGATTCGAATT
CCATCATGTCAGTGAATCGCGCGTTTGACCTAGTCATTCGACTTGAACACACCAAATCCAAATCGAAAAGAATCTATCATCTATACACTTTTCTATCATGCATACACATTATTGTAGTAT
ATCTGATTCTTTTTGCTTTTTAAATTTTTGAAGGGATGTGATGCATCAGTGCTGCTAAACTCAAAAGGAAGCAACAAAGCAGAAAAAGATGGACCACCAAATGCATCTTTGCATGCATTC
TTTATCATTGATAATGCAAAGAAAGCATTAGAAGCTGCTTGCCCTGGTGTAGTCTCTTGTGCTGATATCTTAGCTTTTGCAGCAAGGGATGCTGTATTTCTG
GTATATAATATATAAGCA
AAGCTAAAAAAACTAAAAAAGTTAGGTTTAAATATGTCTTCATCCAGTAATTTATCATTTCTTACTTTTAGTCTCAGTAAAAATATTTTTGTTTGCTTTTAGTCCTTACAAATATACCAC
CTTTTAATCCCTCCAAAACTTATTCATATTATTTAGAATTGATCCCGATAATATGTAGAATATTTGGTTTAGTCCCTCAAAATAAGGACTAAAATTATTATTACACGGATCGATTTCAAT
ATGAACAAATTTTGCAGGACTAAAACAAAACACCAAGTATCAAAAGCAAAAAGTGGTATATTTGCAAGGACTAAAAAACATGGTTAAAATTTTCATCACATAACTAAGGATCCTATATAT
ACAACCATGGTTAATGTTGATACAATATTATTGCAGTCTGGAGGTCCAAGTTGGGATATTCCTAAAGGAAGAAAGGATGGAAGAATATCCAAGGCCAGTGAAACCATACAGTTACCGTCA
CCATCTTTTAACATATCACAACTACAGAAGAGCTTCTCTCAAAGAGGTCTGTCGATGGAAGACTTGGTAGCTTTGTCAG
GTAAAAATATTACAAGCCCAAAACTTCACCATTTACTAAAA
ATAAATTTAATCAGCTTTGTCTGGGAATGAAATTTGCTCCGGAATACCAATAAATCTCATATTACTTGAAAATCGAGGCTTAGGTACTTTACAAACACTCACACTCCACAATCCAACAAA
ACACCTTTTAACTAACGACAAAACCATGAAGACTTACACATGAGACCCAAAGTGGACAATACCTCAAAAAGGCAATGTAGTGGACTTGAGGTTGAAACGTTGGTGTCGTCTATGGGAATC
AAGGGCCTAAGCCAGTACGCACAAGGGATGATAGACCCTTTCTGCTTGACCAGGATATTGTTCCAATACACTAAAAAGTCCCACGTTACTTGGGAATCGAGGCTACACCAAAAAGTCTCA
CATTGCTTGAAAATCGAGACTAAGAGTGGTTTATAATCACTCACACTCCTCAATCCACTTACACACAAAACCCAAAGTGGCCAATATGTTGACTTAATTGAAAAGCACCTTGGTAGGTTG
AGGAATGAGGAGTGTGCGTGTTTATAAACCACCTTTAGCCTCCATTTTCTAGCAATGCGATGCTTTTTGGTGCACCACATCTCTAATTTTGTCTAATTTTATATATATTTTTCTCTCTCA
CTCTCTAAATTCCATAGTTAATTCAATTATTTCTAGTAGTCTTATTATAATCTATACATGAGTATGATTTACAGTGATGGCTCTTTTTACCCTTATGTAGGAGGACATACCTTAGGATTC
TCTCACTGCTCATCCTTCAGAAACAGAATCCATAATTTTGATGCTACACATGATGTGGACCCTTCATTAAATCCATCATTTGCATCAAAGCTAAAATCGATTTGTCCAATAATAAATCAA
GTAAAGAATGCAGGCACCACATTGGATGCTTCTTCAACTACATTTGATAATACATATTACAAGTTGATCCTCCAAAGGAAGGGCATATTTTCTTCTGATCAAGTTCTTATTGATACTCCA
TATACCAAAGATCTTGTTTCTAAGTTTGCTACCTCACAAGATGAATTTTACAAGGCTTTTGTGAAGTCAATGGTCAAAATGAGTAGCATCAATGGTGGTCAAGAGATTAGGAAGGACTGC
AGGGTGGTTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCAATATCATGGTTACATTATTCTTGAGTTTAATTCTCTTGTTTTCAATAGTTTCAACAGGGAATTCACTTAGTTACAACTACTATGAAAAGACATGCCCTGATGTAGAGTTT
ATTGTTGCCAAGACAGTTAAAGCTGCCACTGCTTCAGACAAAACTGTCCCTGCAGCGCTTCTCCGAATGCACTTCCATGACTGCTTCATTCGG
GGATGTGATGCATCAGTGCTGCTAAAC
TCAAAAGGAAGCAACAAAGCAGAAAAAGATGGACCACCAAATGCATCTTTGCATGCATTCTTTATCATTGATAATGCAAAGAAAGCATTAGAAGCTGCTTGCCCTGGTGTAGTCTCTTGT
GCTGATATCTTAGCTTTTGCAGCAAGGGATGCTGTATTTCTG
TCTGGAGGTCCAAGTTGGGATATTCCTAAAGGAAGAAAGGATGGAAGAATATCCAAGGCCAGTGAAACCATACAGTTA
CCGTCACCATCTTTTAACATATCACAACTACAGAAGAGCTTCTCTCAAAGAGGTCTGTCGATGGAAGACTTGGTAGCTTTGTCAG
GAGGACATACCTTAGGATTCTCTCACTGCTCATCC
TTCAGAAACAGAATCCATAATTTTGATGCTACACATGATGTGGACCCTTCATTAAATCCATCATTTGCATCAAAGCTAAAATCGATTTGTCCAATAATAAATCAAGTAAAGAATGCAGGC
ACCACATTGGATGCTTCTTCAACTACATTTGATAATACATATTACAAGTTGATCCTCCAAAGGAAGGGCATATTTTCTTCTGATCAAGTTCTTATTGATACTCCATATACCAAAGATCTT
GTTTCTAAGTTTGCTACCTCACAAGATGAATTTTACAAGGCTTTTGTGAAGTCAATGGTCAAAATGAGTAGCATCAATGGTGGTCAAGAGATTAGGAAGGACTGCAGGGTGGTTAATTAG

Retrieve as FASTA