Entry information : MtPrx93 (Medtr4g132490.1[4.0] / Medtr8g147160.1[3.0])
Entry ID 2823
Creation 2006-03-02 (Christophe Dunand)
Last sequence changes 2006-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx93 (Medtr4g132490.1[4.0] / Medtr8g147160.1[3.0])
Name (synonym) MtPrx93 (Medtr4g132490.1[4.0] / Medtr8g147160.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx93
start..stop
S start..stop
GmPrx324 520 0 1..327 1..327
GmPrx166 514 0 1..327 1..327
EgrPrx85 407 1e-143 16..327 12..319
EglPrx85 407 1e-143 16..327 12..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55383776..55383997 222 N° 2 55384075..55384432 358 N° 3 55384823..55385226 404  
join(55383776..55383997,55384075..55384432,55384823..55385226)


exon

Literature and cross-references MtPrx93 (Medtr4g132490.1[4.0] / Medtr8g147160.1[3.0])
Literature Lin,S., Dixon,R., May,G., Sumner,L., Gonzales,B., Cook,D., Kim,D. nd Roe,B.A. Medicago truncatula BAC Clone mth2-187n4.
DNA ref. Phytozome 12:   chr4 (55383776..55385226)
Cluster/Prediction ref. Phytozome Gene 12:   31109254
Protein sequence: MtPrx93 (Medtr4g132490.1[4.0] / Medtr8g147160.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (304)
PWM (Da):   %s   35840.99 (33384.6)  
PI (pH):   %s   5.79 (6.27) Peptide Signal:   %s   cut: 24 range:24-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEISLPLILLSTVVIMAMPLSFGVKGNQLSYNYYKNSCPNLESLVERELMSVFMTDIRAPSAFLRLMFHDCQVQGCDASILLDTIYATQSSEIASSGNFAIRNRETINDIKSVLEEECPGQVSCADIIVLAAKVSVSLSGGPSIQVPFGRKDSRTSSSKEADAKLPSPTVTVDEFLSIFKSKGMNIQESVAILGAHTLGVGHCLSIVGRLYNQNQQIGNNMNLGYETSLRLACPTVIPMTNLTFVPNDMTPTIFDNQYYRDIMMGRGLLGIDSSISRDPRTAPIVMRFAMDQSYFFENFSSAFVKLSASNVLTNIQGEVRRKCNQLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1 and 3). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAATATCTCTTCCTTTGATTCTTCTTTCCACTGTGGTTATTATGGCTATGCCACTTTCATTTGGTGTAAAAGGAAACCAACTTTCTTACAACTACTACAAGAATTCTTGTCCAAAC
TTGGAAAGTTTGGTCGAGAGAGAATTGATGAGCGTATTCATGACAGATATTCGTGCACCATCAGCATTTCTAAGGCTCATGTTTCATGATTGCCAAGTTCAG
GTAATTCCTAGATAGGTG
TTTTTTATGTCGTTCAAGGTTGCTTGGACCTCACTTTGTTTGTATTAATTTGCATGCAGGGATGTGATGCCTCGATTTTGTTGGACACAATCTACGCTACTCAAAGCTCTGAAATAGCTT
CTTCAGGAAACTTTGCAATCAGAAATAGGGAAACAATCAACGACATAAAATCGGTATTAGAAGAAGAATGTCCGGGGCAAGTGTCTTGTGCAGATATCATTGTATTAGCTGCTAAGGTAT
CAGTGTCACTCTCTGGAGGACCAAGTATTCAGGTTCCATTTGGAAGAAAAGATTCAAGAACTTCTAGTTCTAAAGAGGCTGATGCTAAGCTTCCTTCACCGACAGTAACAGTTGATGAAT
TTTTATCCATTTTCAAATCTAAAGGAATGAACATTCAAGAATCTGTTGCCATTTTAG
GTAATGCATACCAACCATAAATTAGTTGAACTCATTTCGTCAGGGAAAGTCTCAAAAAGTATA
AGTTTTACACAATTCCCACGTGCAGCCAACATTTTTTCCTCCCTTTTTACCAAGAATTATGGGTGTGACTTGTGAGAAATCTCAAATATCTGCTCTTTTTGTTGGTGGTTGAGAACTATT
AGCTTCATATAATCCATTTTCGGGATAGACCTCATGATATCCAGATATACAACTCATGAACACTTAATTTTTAAATTCCTAATAGCATTTGACATTTTATTTTATTTTTACTTTTGTCAT
TTAAAGTGTTATACTAATTAATACAGATAAAAACTGTTACCTAAGACAAGCAATAGTTTTTGATCTGTTACTATTATTATTTTACAGGTGCACATACATTAGGTGTTGGACACTGCTTAA
GCATTGTTGGCAGATTGTATAATCAAAATCAACAGATAGGAAACAATATGAATTTGGGTTATGAAACCTCACTAAGACTAGCATGCCCAACTGTTATTCCTATGACAAACCTAACATTTG
TGCCTAATGACATGACCCCAACAATATTTGACAATCAATATTACCGAGACATTATGATGGGAAGAGGTTTGCTTGGTATTGACTCGAGCATTTCTAGAGATCCACGAACTGCACCCATTG
TCATGAGGTTTGCTATGGATCAGAGCTACTTCTTTGAGAACTTCTCATCTGCATTTGTTAAGCTTTCTGCTAGCAATGTTCTCACAAATATTCAAGGTGAAGTCAGAAGGAAATGCAACC
AGCTAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAATATCTCTTCCTTTGATTCTTCTTTCCACTGTGGTTATTATGGCTATGCCACTTTCATTTGGTGTAAAAGGAAACCAACTTTCTTACAACTACTACAAGAATTCTTGTCCAAAC
TTGGAAAGTTTGGTCGAGAGAGAATTGATGAGCGTATTCATGACAGATATTCGTGCACCATCAGCATTTCTAAGGCTCATGTTTCATGATTGCCAAGTTCAG
GGATGTGATGCCTCGATT
TTGTTGGACACAATCTACGCTACTCAAAGCTCTGAAATAGCTTCTTCAGGAAACTTTGCAATCAGAAATAGGGAAACAATCAACGACATAAAATCGGTATTAGAAGAAGAATGTCCGGGG
CAAGTGTCTTGTGCAGATATCATTGTATTAGCTGCTAAGGTATCAGTGTCACTCTCTGGAGGACCAAGTATTCAGGTTCCATTTGGAAGAAAAGATTCAAGAACTTCTAGTTCTAAAGAG
GCTGATGCTAAGCTTCCTTCACCGACAGTAACAGTTGATGAATTTTTATCCATTTTCAAATCTAAAGGAATGAACATTCAAGAATCTGTTGCCATTTTAG
GTGCACATACATTAGGTGTT
GGACACTGCTTAAGCATTGTTGGCAGATTGTATAATCAAAATCAACAGATAGGAAACAATATGAATTTGGGTTATGAAACCTCACTAAGACTAGCATGCCCAACTGTTATTCCTATGACA
AACCTAACATTTGTGCCTAATGACATGACCCCAACAATATTTGACAATCAATATTACCGAGACATTATGATGGGAAGAGGTTTGCTTGGTATTGACTCGAGCATTTCTAGAGATCCACGA
ACTGCACCCATTGTCATGAGGTTTGCTATGGATCAGAGCTACTTCTTTGAGAACTTCTCATCTGCATTTGTTAAGCTTTCTGCTAGCAATGTTCTCACAAATATTCAAGGTGAAGTCAGA
AGGAAATGCAACCAGCTAAACTAG

Retrieve as FASTA