Entry information : OsGPx04 (Os06g0185900)
Entry ID 2870
Creation 2007-08-15 (Christophe Dunand)
Last sequence changes 2007-08-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsGPx04 (Os06g0185900)
Name (synonym) OsGPx04 (Os06g0185900)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsGPx04
start..stop
S start..stop
OruGPx04 462 1e-168 1..225 1..225
OsiGPx04 405 3e-146 1..225 1..223
TaGPx04-1A 326 1e-114 15..225 5..220
ZmGPx04 324 5e-114 55..225 49..221
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4332529..4332777 249 N° 2 4333588..4333664 77 N° 3 4333774..4333835 62 N° 4 4334016..4334134 119
N° 5 4334237..4334404 168 N° 6 4334705..4334728 24  
join(4332529..4332777,4333588..4333664,4333774..4333835,4334016..4334134,4334237 ..4334404,4334705..4334728)


exon

Literature and cross-references OsGPx04 (Os06g0185900)
Protein ref. GenPept:   BAD72440   BAF18920 UniProtKB:   Q0DE03   Q5SMW6 [Incorrect splicing] UniProtKB_Uniparc:   A3B930 [Incorrect splicing]
DNA ref. GenBank:   NC_008399.1 (4332529..4334725)
Cluster/Prediction ref. UniGene:   Os.7552
Protein sequence: OsGPx04 (Os06g0185900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   232
PWM (Da):   %s   24802.8  
PI (pH):   %s   10.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTTTTTAAAAARFTCLAPATRPASASASAGRFLLPARQWGAATTHGSAAVPVVAAPSRRWAPGVAYATAATGKSVHDFTVKDIDGKDVALSKFKGRALLIVNVASQCGLTTANYTELSHLYEKYKTGFEILAFPCNQFGAQEPGSNPQIKQFACTRFKAEFPIFDVDVNGPNTAPIYKFLKSSAGGFLGDLVKWNFEKFLVDKTGKVVERYPPTTSPFQIEVLMVRQP*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 38 ESTs (TC from TGI) and 46 EST (UniGene Os.7552 which compile japonica and indica together). Two TREMBL accessions: Q5SMW6 and A3B930 both contain extra sequences not confirmed by ESTs (splicing prediction error).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCACCACCACCACCACGGCGGCGGCCGCGGCCCGCTTCACCTGCCTCGCGCCGGCCACGCGCCCCGCCTCCGCCTCCGCCTCCGCGGGCCGCTTCCTCCTCCCGGCGCGGCAG
TGGGGGGCGGCGACGACGCACGGGAGCGCGGCGGTGCCCGTCGTCGCGGCGCCGTCGCGGAGGTGGGCGCCAGGGGTCGCCTACGCCACCGCCGCCACCGGGAAGAGCGTCCACGACTTC
ACCGTCAAG
GTTGTGGCATTTCGAGCCCTCGTGATTTCGATCCCTTTTGCCCCTCGTGGTACTGGTACTGGTACCGCCCCCGCGCTTTAGTTTGGATTCGTTGCGTGTGATGTGACGATG
GGATATGGGTGAGGGCATGAGGCGCGTTAGGTTTTGAGAATTTGGATGTTGCGGTGTGTGTGGTTGATGTGGCTGGTAGTGTTGTTGAGGTAGGTACACCTTGGAAGCACGTATATATCG
ATAGATTATCGTTTAAATTTTGTTCTGTTGTTGAACGTGTTTGCAATTGGCTGGGTCAGGTGAATGCTGTTTTGTTTTTTAGATAATGGAAACGGATTAAGGTGAATGCTGTTGTATTTA
CAAAATCTCCTGTTTTGACATTATTTTTTTAGATAATGGAAGCTTTGATTGAACTCAACAATTACATCAAGGCGATACAATTATCCTGAGAACACTTCCAACCTCTCATGTTATGACATT
ATAACATTAGCAAATCAGCTATCGCCTATCAGGGGCGTCCTGTATCAGAATTGTTGGTACTTAGGTAGAAATGATGTGCTGAATTTCAGTAACTAGGTATTTTTGAGGTTTGTCTGAGTC
ATAGGCTTATAAGTGCACATAACTGTAACCATAGATTGATCACCGAAAGATGTGTCGTTGAACGTGATTGAAATTTAGCCAAATCAGATTAATGCAGTCAGAAGCTTTGTTGGTTTGTAC
TGCAAATTGACATGTCACAGCTCCAGCTATCAAGGGCACATTGTGCCAGAATTATAGGTTGAGATGCATGCCTGAACAAAATTGCTCTGTTTTGTGCAGGACATTGATGGAAAAGATGTT
GCGCTTAGCAAGTTCAAGGGAAGGGCGCTGCTAATTGTTAATGTTGCATCTCAGTG
GTATTTTTTCTTAATACATTGCTCCTCTGATATACTGTATACTAATATAGTAAGTTATACAGCA
TTACCTGGCATTAAACTTCACGCTGTTCTTTAAATTAAATTCCAGTGGGCTGACAACAGCAAATTACACGGAACTATCTCATCTTTATGAGAAGTACAAGACTCAAGGTAATATAATCAC
TGGTTTAGGTTTTGGTGCATTGAATTGTTCAGCTATTGCATAAGAAACTAGACAACACTTGGCTCTTTTATTTTCTTTTTTCAAAGCTTCTGTAGGCATGGAATGAACATGGATTCATAT
ACTGTATGCGATATCACCTTAGTCCAATACTTCATCTGATTTTGCAGGATTTGAGATTCTTGCATTTCCTTGCAATCAGTTTGGTGCACAAGAACCTGGGTCAAACCCGCAGATTAAGCA
GTTTGCTTGTACAAGGTTTAAAGCTGAATTTCCTATTTTTGACAAG
GTATGTTAACTCCATTGTAAGAAGCGATTGGCTCAATATTTCCTGCCAATTAATAGTATATGAATGCATGATGC
ATTTCTGTGCTTGTACGTGCAATGGCAGGTTGATGTCAACGGGCCTAACACAGCCCCTATTTATAAGTTTCTTAAGTCGAGTGCTGGAGGATTTTTGGGTGATCTTGTGAAATGGAATTT
TGAGAAGTTCTTGGTGGACAAAACTGGAAAAGTTGTTGAGAGATACCCACCTACAACTTCACCATTCCAGATTGAG
GTGAATTTTGTTTCTGCCTTTATCATAACACCCTTGCTTTATTG
TATTCGCTTGGTTTGCCAGATTGAGTTCTCGAAATATATTTTTTTCTGTACAACTTTGAAGATCAATGAAATAATTCATATCTATCAATATGTATTGTAACCTTACTAACTTCAGTTATC
TGTCTCTACTAAGATTCCCAACATATGTTACACTGCATTTGTAAGAAGATTAATGGACTAGCCTTTGTGAGCCTACCATGTATGCATACTTTTGGAAAGAAGCAAGCATGTTTTGCATAT
TTTTTTGTGTACCTAGGTACTGATGGTGAGGCAGCCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCACCACCACCACCACGGCGGCGGCCGCGGCCCGCTTCACCTGCCTCGCGCCGGCCACGCGCCCCGCCTCCGCCTCCGCCTCCGCGGGCCGCTTCCTCCTCCCGGCGCGGCAG
TGGGGGGCGGCGACGACGCACGGGAGCGCGGCGGTGCCCGTCGTCGCGGCGCCGTCGCGGAGGTGGGCGCCAGGGGTCGCCTACGCCACCGCCGCCACCGGGAAGAGCGTCCACGACTTC
ACCGTCAAG
GACATTGATGGAAAAGATGTTGCGCTTAGCAAGTTCAAGGGAAGGGCGCTGCTAATTGTTAATGTTGCATCTCAGTGTGGGCTGACAACAGCAAATTACACGGAACTATCT
CATCTTTATGAGAAGTACAAGACTCAAG
GATTTGAGATTCTTGCATTTCCTTGCAATCAGTTTGGTGCACAAGAACCTGGGTCAAACCCGCAGATTAAGCAGTTTGCTTGTACAAGGTTT
AAAGCTGAATTTCCTATTTTTGACAAG
GTTGATGTCAACGGGCCTAACACAGCCCCTATTTATAAGTTTCTTAAGTCGAGTGCTGGAGGATTTTTGGGTGATCTTGTGAAATGGAATTTT
GAGAAGTTCTTGGTGGACAAAACTGGAAAAGTTGTTGAGAGATACCCACCTACAACTTCACCATTCCAGATTGAG
GTACTGATGGTGAGGCAGCCCTAA

Retrieve as FASTA