Entry information : PtAPx07 (POPTR_0005s20140 / Potri.005G179200)
Entry ID 2878
Creation 2010-04-09 (Christophe Dunand)
Last sequence changes 2010-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtAPx07 (POPTR_0005s20140 / Potri.005G179200)
Name (synonym) PtAPx07 (POPTR_0005s20140 / Potri.005G179200)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation Chloroplastic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtAPx07
start..stop
S start..stop
PtAPx08 711 0 18..424 1..409
MeAPx05 698 0 1..424 1..428
EguAPx08 665 0 18..424 26..446
EglAPx08 656 0 18..424 26..446
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19542503..19542727 225 N° 2 19542311..19542421 111 N° 3 19542024..19542144 121 N° 4 19541840..19541940 101
N° 5 19541666..19541753 88 N° 6 19541490..19541557 68 N° 7 19541320..19541406 87 N° 8 19540429..19540503 75
N° 9 19540245..19540322 78 N° 10 19540055..19540159 105 N° 11 19539523..19539585 63 N° 12 19539062..19539214 153
complement(join(19539062..19539214,19539523..19539585,19540055..19540159,1954024 5..19540322,19540429..19540503,19541320..19541406,19541490..19541557,19541666..1 9541753,19541840..19541940,19542024..19542144,19542311..19542421,19542503..19542 727))


exon

Literature and cross-references PtAPx07 (POPTR_0005s20140 / Potri.005G179200)
Literature JGI
DNA ref. Phytozome 12:   Chr05 (19542727..19539062)
Cluster/Prediction ref. JGI gene:   559250 [Incorrect prediction]
Omic ref. ePlant:   Potri.005G179200
Protein sequence: PtAPx07 (POPTR_0005s20140 / Potri.005G179200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   424
PWM (Da):   %s   46021.65 Transmb domain:   %s   o404-423i
PI (pH):   %s   8.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQYLSQLTLSPPKSQPMASLSGGAATTSRLLPSASRVRLSICSASSSLSLASSSSYSPSSLKCLRFSPLIFKDQKRSSMSTVAAASDAAQLKSAREDIKELLKSKFCHPILVRLGWHDAGTYNKNIEEWPKRGGANGSLRFEIELKHAANAGLVDALKLIQPIKDKYSGVTYADLFQMASAAAIEAGGPKIPMKYGRVDVSVPDECPEEGRLPDAGPPKPADHLREVFYRMGLDDEIAALSGAHTLGRSRPERSGWGKPETKYTKNGPGAPGGQSWTAEWLKFDNSYFKDIKERKDEDLLVLPTDAALFEDPSFKVYAEKYAEDKEAFFKDYAEAHAKLSNLGAKFDPPEGIMLDGVAGEKFVAAKYSSGKRELSETMKQKIRAEYQAVGGSPDKPLQSNYFLNIIIVIAVLALLTSLLGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns). Incorrect prediction from JGI (very small last exon: 1 aa; or alternative splicing which could be confirmed by ESTs from populus hybrids: CV278216.1, CV256725.1, BP930644.1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACAGTACCTCTCCCAACTAACACTATCTCCACCAAAATCGCAACCAATGGCTTCTCTCAGTGGTGGTGCCGCCACCACTTCCCGCCTCCTCCCCTCCGCCTCTCGCGTCCGTCTC
TCTATTTGTTCAGCTTCCTCCTCACTCTCTCTTGCCTCCTCCTCCTCTTACTCTCCTTCCTCTCTCAAATGCCTCCGATTCTCACCCCTCATTTTTAAGGATCAG
GTCTCACTTCCTCTC
CCACTCTATATATAAATAAATTATATTGCGCTGGCTGTTTTTTTCCGATTTGTTTTTTGAGTGTAGAAGCGATCGTCAATGAGCACCGTTGCTGCGGCGTCGGATGCTGCTCAGTTGAAG
AGTGCGAGAGAAGATATCAAGGAGCTTCTTAAATCTAAATTTTGCCATCCTATTCTG
GTAATACTGTTTTATTATTTATTTTAATTTACTTGATATAAACATTTTTTTTCTCTTTAAATT
TCAATGATCAACTCATAATAAATTGCATAATTATTTGCTAGCCAAGTAAAAATTTCGCTTTCTAGTTTCTGTGCTGATATAATGCTGTTGTTTTCTTTTATAGGTTCGGTTGGGGTGGCA
TGATGCAGGCACATACAACAAGAACATAGAGGAGTGGCCAAAAAGGGGTGGAGCCAATGGAAGTCTTAGATTTGAAATTGAACTTAAGCATGCAGCCAATGCAG
GTAATTGTTTCACATT
TTAATTAGTGTAACTAATAATTAGCTTGGTTCTGTAATATTTGTTGCCTAATTAACTGGTATTTTAGGGCTTGTTGATGCATTGAAACTGATTCAGCCTATCAAAGACAAGTATTCTGGT
GTGACATATGCGGATTTGTTCCAAATGGCCAGCGCAGCTGCTATAGAG
GTCTAGGTTGCTCTTCTGTGGATTTAACGTGATTTGTTTGAAATCATTGTTTAAACATTTTATTGATAAATG
TGTTGCGGTTTTAGGAAGCCGGAGGCCCCAAAATTCCCATGAAGTATGGCAGGGTGGATGTCTCAGTCCCTGATGAATGCCCTGAAGAGGGGAGGCTTCCCGGTAAGTATTTTCAGTTTG
AATCCTTTCTTGTAATAAATGTTTTTCATAAACTTAATGCTTGTTAACTACAGTTTAGTATTGATATCTAAAATTCTAATTGGTGCATAGATGCTGGCCCCCCTAAACCTGCTGATCATT
TACGAGAAGTTTTCTATAGAATGGGATTAGATGACAAG
GTAATCTTAATTGTATATCATGCTTTGCTTGATGCTATCTCAATGTGTATATTATGTTTGCTGTTTAAGTCTTTAAACTGCA
GGAAATAGCTGCATTGTCTGGTGCACACACACTTGGAAGGTCTAGACCAGAACGCAGTGGTTGGGGCAAACCAGAGACGAAGTATACGGTATTAGAGCGACTTCGTCCAATTTTTTAGAA
TATAAGTATTTCTAGAGTTGCTTAATCATAGACTGCGCAATCATCATTTATTACTGTTATTAATGTGTCATTTCAATATGGAGATTCCATAGACTTTTATGTCTCATTAAGGTTAAATTA
CTAGTAACTAATTGATTCCATATGCAACAGTAGATATAGCTTTATGTATACTACACAAGTGAGGAATTCTAGGTGATGGTTCCTAGTGATTTCTCAATCTCATATTCAGAGTTACCTTGA
AAGATTTATGTAATCCTCAATAACCATTTATCCTGAATGCGCAACCAGTAACTTTGATTTCTATACATCTTCCTTCTCATTTGACATCACTGTGAACTGGGAGCATATCTTTTGGTCATG
GGCTAATAATTGTTCGAATGAGATGCTAGAAACTGACTACTGGTCAAACGTTTCCTTCTCTCTCTATATTCTCTATTTTCTGGAGAATTGCAACTAGTGATATATGATTATAGCCGCCAG
GCAATTCTTAAAGCTAAAACATGCAGTTGAGATGTTAGATCTCTATTACAACTTCCTTATTAACTACTACCGTTTCCTCTGTATTCTTTTTGTCCTTGATAAAACGTACAGCTGAGCATT
TGACATAGGATTATTGCATGTTTTCCAGTTTACAAATATATGTAATTGATGGTTTATCTTTGATATCACCATCAGGATCCTTTTGTCTCATCTTGCAGCATGTATAGAGGGTAGTAATAG
AAACAGTAGTAGCTATAGAAAGCATCGACAGTTGGATATTTACATTTTATCTGCTGCTTGACAGAAAAATGGGCCTGGAGCACCAGGAGGGCAGTCCTGGACAGCAGAATGGCTGAAGTT
TGACAATTCCTACTTCAAG
GTTTGACAATCAGAACGTGCTACTTATACCATAAGAAAGATATAAAAATTTGGGTTGGGGAGTGGGGGTGTTACAATGCTTTGCTGAATATGATTTACCTG
CACAGGATATTAAAGAAAGAAAGGATGAAGATCTACTTGTATTGCCAACTGATGCTGCTCTTTTTGAAGATCCTTCATTCAAGGTAAAATGGATTGAGGTTTGAGAGTAAGATGGTCAAG
AAGCACATAACAATCTTTTTAATCAGCTAAGCATCGCATAAACTGCAGGTGTATGCAGAGAAATATGCTGAAGATAAGGAGGCATTCTTCAAGGATTATGCTGAAGCCCATGCGAAGCTC
AGCAATCTTGGGGCAAAATTTGATCCTCCAGAG
GTTTGTTAGCCAAGTGTTGTCCCGAGATGCTCAATTCATGTCTTTCGCCTTTACCCATGTTCTAATGATTACCATAACTGCCCTTGA
AAATATTTGAAAGGTCTTGGTCAAATGTTCATCTTATATATGCAACTCAGTTTTTTCAGAAAAAAATAAATTTGAGAGCTTATGATGGCTGATGTTTACGATTTCTAAGCCTTGTAAAAT
AGTTCCTGATTGATGACATGTCATGTGAATGTGCTTTCACTCACAACTGCGCATGCACACATTCTTTCCATGAACTCCGGGGTTAGATCTAACTAACCCTTTGTTAACTTGTCCATGCAT
GCTTACCTACACATACACCGTCTTTTAAAGTCTTTTTCTATGTTTAATTTATTGGAACTCCCACGATTAGATTCAATTGTAAAGTACAATGGTTGCAAGAAAGTTTGTAACTTGAAAAAC
TAATTGATGATTTGGTGATCAGGGAATTATGCTAGATGGTGTTGCAGGAGAGAAGTTTGTGGCAGCCAAGTACTCCTCTGGAAAGGTCGTAATTACAATCAAGTTGTTGCAAAACGTTCT
GTTAATTATTAATCATAAAAGTTCCTTGGTTTTTAGGGTTGCATGGATGATTTATATGGCAGAAGTATACGTATGCAAAATGTTCATTTTTTCACTTTTCATGATTCACTGCAGGACTAA
AAAACAAGCATCTTGTTTTCTAGTGCCGTTTCTTTTAATAATACAGACAGGATGAAGCTATTTGCAATTTTTGTGAAATCACATATAAAACTTGGAAGTCTAAATGAAGAAGAAAGGAAT
AAATTCAACTAGTGTTGCCTATTTGAATTGCAGAGAGAGTTGTCAGAGACTATGAAACAGAAGATTAGAGCAGAGTATCAAGCAGTTGGCGGGAGCCCAGATAAGCCTCTCCAGTCTAAC
TATTTTCTAAATATCATTATTGTGATTGCTGTTCTAGCACTTTTAACATCTCTTCTTGGAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACAGTACCTCTCCCAACTAACACTATCTCCACCAAAATCGCAACCAATGGCTTCTCTCAGTGGTGGTGCCGCCACCACTTCCCGCCTCCTCCCCTCCGCCTCTCGCGTCCGTCTC
TCTATTTGTTCAGCTTCCTCCTCACTCTCTCTTGCCTCCTCCTCCTCTTACTCTCCTTCCTCTCTCAAATGCCTCCGATTCTCACCCCTCATTTTTAAGGATCAG
AAGCGATCGTCAATG
AGCACCGTTGCTGCGGCGTCGGATGCTGCTCAGTTGAAGAGTGCGAGAGAAGATATCAAGGAGCTTCTTAAATCTAAATTTTGCCATCCTATTCTG
GTTCGGTTGGGGTGGCATGATGCA
GGCACATACAACAAGAACATAGAGGAGTGGCCAAAAAGGGGTGGAGCCAATGGAAGTCTTAGATTTGAAATTGAACTTAAGCATGCAGCCAATGCAG
GGCTTGTTGATGCATTGAAACTG
ATTCAGCCTATCAAAGACAAGTATTCTGGTGTGACATATGCGGATTTGTTCCAAATGGCCAGCGCAGCTGCTATAGAG
GAAGCCGGAGGCCCCAAAATTCCCATGAAGTATGGCAGGGTG
GATGTCTCAGTCCCTGATGAATGCCCTGAAGAGGGGAGGCTTCCCG
ATGCTGGCCCCCCTAAACCTGCTGATCATTTACGAGAAGTTTTCTATAGAATGGGATTAGATGACAAGGAAATA
GCTGCATTGTCTGGTGCACACACACTTGGAAGGTCTAGACCAGAACGCAGTGGTTGGGGCAAACCAGAGACGAAGTATACG
AAAAATGGGCCTGGAGCACCAGGAGGGCAGTCCTGGACA
GCAGAATGGCTGAAGTTTGACAATTCCTACTTCAAG
GATATTAAAGAAAGAAAGGATGAAGATCTACTTGTATTGCCAACTGATGCTGCTCTTTTTGAAGATCCTTCATTCAAGGTGTAT
GCAGAGAAATATGCTGAAGATAAGGAGGCATTCTTCAAGGATTATGCTGAAGCCCATGCGAAGCTCAGCAATCTTGGGGCAAAATTTGATCCTCCAGAG
GGAATTATGCTAGATGGTGTT
GCAGGAGAGAAGTTTGTGGCAGCCAAGTACTCCTCTGGAAAG
AGAGAGTTGTCAGAGACTATGAAACAGAAGATTAGAGCAGAGTATCAAGCAGTTGGCGGGAGCCCAGATAAGCCTCTC
CAGTCTAACTATTTTCTAAATATCATTATTGTGATTGCTGTTCTAGCACTTTTAACATCTCTTCTTGGAAATTAA

Retrieve as FASTA