Entry information : GmPrx86 (sEpa2 / Glyma12g32160.1)
Entry ID 288
Creation 2006-10-30 (Christophe Dunand)
Last sequence changes 2011-12-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx86 (sEpa2 / Glyma12g32160.1)
Name (synonym) GmPrx86 (sEpa2 / Glyma12g32160.1)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Floral meristems
Germinating seeds
Germinating shoots
Hypocotyls
Immature flowers
Plumules
Roots
Roots of 'Supernod' plants
Seed buds
Seedling epicotyls
Seedlings
Inducers Bradyrhizobium inoculation
Elicitor treatment (glucan, oligosaccharides, yeast extract, Phytophthora crude extract)
Nodulation
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx86
start..stop
S start..stop
GmPrx12 656 0 3..326 1..324
GmPrx55 642 0 1..326 1..326
GmPrx11 639 0 1..326 1..326
LjPrx13 571 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35716838..35717047 210 N° 2 35717141..35717329 189 N° 3 35717472..35717634 163 N° 4 35717920..35718338 419
join(35716838..35717047,35717141..35717329,35717472..35717634,35717920..35718338 )


exon

Literature and cross-references GmPrx86 (sEpa2 / Glyma12g32160.1)
Literature Chen,H. and Vierling,R.A. Molecular cloning and characterization of soybean peroxidase gene families. Plant Sci. 150 (2), 129-137 (2000).
Protein ref. UniProtKB:   Q9ZNZ5
DNA ref. Phytozome 12:   Gm12 (35716838..35718338)
Protein sequence: GmPrx86 (sEpa2 / Glyma12g32160.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (303)
PWM (Da):   %s   35557.06 (33051.8)  
PI (pH):   %s   7.5 (6.98) Peptide Signal:   %s   cut: 24 range:24-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMGSNFRFLSLCLLALIASTHAQLQLGFYAKSCPNAEQIVLKFVHDHIHNAPSLAAALIRMHFHDCFVRGCDASVLLNSTTNQAEKNAPPNLTVRGFDFIDRIKSLVEAECPGVVSCADILTLSARDTIVATGGPFWKVPTGRRDGVISNLTEARDNIPAPSSNFTTLQTLFANQGLDLKDLVLLSGAHTIGIAHCSSLSNRLFNFTGKGDQDPSLDSEYAANLKAFKCTDLNKLNTTKIEMDPGSRKTFDLSYYSHVIKRRGLFESDAALLTNSVTKAQIIELLEGSVENFFAEFATSMEKMGRINVKTGTEGEIRKHCAFVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic, 41 ESTs and 1 cDNA. (U51192).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGGGAAGCAACTTCAGGTTTTTGAGTCTTTGCCTCTTGGCATTGATTGCATCAACCCATGCTCAACTTCAGCTTGGTTTTTATGCCAAGAGTTGCCCAAACGCTGAGCAAATC
GTTTTGAAATTTGTCCATGACCATATCCACAATGCTCCATCACTAGCAGCTGCATTGATAAGAATGCACTTCCATGACTGTTTTGTAAGG
GTATGTGCTACAATCTTTAAGCTCCTTCCA
TTTTTACTTAACAAGTACAATGTTAGATTAAAGTTAAGGAGCTAATAAGATGAAGCATTTCAGGGATGTGATGCATCAGTCCTTCTGAACTCAACAACCAATCAAGCTGAAAAGAATGCT
CCTCCAAATCTCACAGTAAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAGGCAGAATGCCCTGGTGTGGTCTCTTGTGCTGATATCCTCACTTTGTCTGCCAGAGACACT
ATTGTAGCCACA
GTAAGTGCTCAATTTCTATCTAGAAAAGCTTAAATATTAGTACAACTTCTGCTTCATCTTTATCTTAAATCTTAACACTTTCTTTTTGAGAACATAAATGACCAATTT
GTATGTTTATGCCATTACTGACATTGGCTTACAGGGTGGACCATTTTGGAAAGTTCCAACAGGTCGAAGAGATGGGGTCATCTCTAACTTGACGGAAGCCAGAGATAACATTCCTGCTCC
ATCTTCTAACTTTACCACCCTACAAACACTCTTTGCCAACCAAGGACTTGATTTGAAGGACTTGGTCCTGCTCTCTG
GTACTATTTATCAAACAATTTTCCAAGTTGAAAATAAATAATT
TAATTTTTAGGATTTTATTAATTATATTTCAAATCTTCAGGATGGTTGATTTGATAAATATAATCATCTAGTTCTTATCATTTAGACTTTAGGACACTATCCGTTTGTTTAATTTTAAGG
TTAAAATGTGTTATTACTTGAATTTTGTTGCACTTTTTTCTTTGAAAAAATATATCAACAAATTGGTGTGAATTATGCATTGTTCTTGTCCTTGTAATCACCAAGAGTTCAAATTGTTTC
AGGTGCTCACACAATTGGTATCGCTCATTGCTCATCATTGTCAAACCGCTTGTTCAATTTCACTGGCAAGGGTGATCAAGACCCGTCATTAGACAGTGAATATGCTGCAAATCTGAAAGC
CTTCAAGTGCACGGACCTCAATAAGTTGAACACCACAAAAATTGAGATGGACCCTGGAAGTCGCAAGACATTTGATCTTAGCTACTATAGTCATGTGATTAAGAGAAGGGGTCTATTTGA
GTCAGATGCTGCATTGTTGACAAACTCAGTTACAAAGGCTCAAATCATTGAATTGCTTGAAGGGTCAGTTGAAAATTTCTTTGCTGAGTTTGCAACCTCCATGGAGAAAATGGGAAGAAT
TAATGTAAAGACAGGGACAGAAGGAGAGATCAGGAAGCATTGTGCATTTGTAAATAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGGGAAGCAACTTCAGGTTTTTGAGTCTTTGCCTCTTGGCATTGATTGCATCAACCCATGCTCAACTTCAGCTTGGTTTTTATGCCAAGAGTTGCCCAAACGCTGAGCAAATC
GTTTTGAAATTTGTCCATGACCATATCCACAATGCTCCATCACTAGCAGCTGCATTGATAAGAATGCACTTCCATGACTGTTTTGTAAGG
GGATGTGATGCATCAGTCCTTCTGAACTCA
ACAACCAATCAAGCTGAAAAGAATGCTCCTCCAAATCTCACAGTAAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAGGCAGAATGCCCTGGTGTGGTCTCTTGTGCTGAT
ATCCTCACTTTGTCTGCCAGAGACACTATTGTAGCCACA
GGTGGACCATTTTGGAAAGTTCCAACAGGTCGAAGAGATGGGGTCATCTCTAACTTGACGGAAGCCAGAGATAACATTCCT
GCTCCATCTTCTAACTTTACCACCCTACAAACACTCTTTGCCAACCAAGGACTTGATTTGAAGGACTTGGTCCTGCTCTCTG
GTGCTCACACAATTGGTATCGCTCATTGCTCATCATTG
TCAAACCGCTTGTTCAATTTCACTGGCAAGGGTGATCAAGACCCGTCATTAGACAGTGAATATGCTGCAAATCTGAAAGCCTTCAAGTGCACGGACCTCAATAAGTTGAACACCACAAAA
ATTGAGATGGACCCTGGAAGTCGCAAGACATTTGATCTTAGCTACTATAGTCATGTGATTAAGAGAAGGGGTCTATTTGAGTCAGATGCTGCATTGTTGACAAACTCAGTTACAAAGGCT
CAAATCATTGAATTGCTTGAAGGGTCAGTTGAAAATTTCTTTGCTGAGTTTGCAACCTCCATGGAGAAAATGGGAAGAATTAATGTAAAGACAGGGACAGAAGGAGAGATCAGGAAGCAT
TGTGCATTTGTAAATAGCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAAGCATCTG AGTGTTTACT ATTTTGTACT ATATTTATAT ATAGTCACTC AAGCTTCTAG GATTTCTGCC TGCTGCATCA AAATGGGAAG CAACTTGAGG TTTTTGAGTC TTTGCCTCTT  GGCATTGATT GCATCGACTC ATGCTCAACT TCAGCTTGGT TTTTATGCTA ACAGTTGCCC AAAAGCAGAG CAAATTGTTT TGAAATTTGT TCATGACCAT ATCCACAATG CTCCATCACT  AGCAGCTGCA TTAATAAGAA TGCACTTTCA TGACTGTTTT GTAAGGGGAT GTGATGCATC AGTCCTTCTG AACTCAACAA CCAATCAGGC TGAGAAGAAT GCTCCTCCAA ATCTCACAGT  AAGAGGCTTT GACTTCATTG ACAGAATAAA GAGCCTTGTT GAAGCTGAAT GCCCTGGTGT GGTCTCTTGT GCTGATATCC TCACTTTGGC TGCCAGAGAC ACTATTGTAG CCACAGGTGG  ACCTTTTTGG AAAGTTCCAA CTGGTCGAAG GGATGGGGTC GTCTCTAACT TGACGGAAGC CAGAAATAAC ATTCCTGCTC CATCTTCCAA CTTTACCACC CTACAAACAC TCTTTGCTAA  CCAAGGACTT GATTTGAAGG ACTTGGTCCT GCTCTCTGGT GCTCACACAA TTGGTATCGC TCATTGCTCA TCATTATCAA ACCGGTTGTT CAATTTCACT GGCAAGGGTG ATCAAGACCC  GTCACTAGAT AGTGAATATG CTGCAAATTT GAAAGCATTC AAGTGCACAG ACCTCAACAA GTTGAACACC ACAAAAATTG AGATGGACCC TGGAAGTCGC AAGACATTTG ATCTTAGCTA  CTATAGTCAC GTTATTAAGA GAAGGGGTCT ATTTGAGTCA GATGCTGCAT TATTGACTAA CTCAGTTACA AAGGCACAAA TCATCCAATT GCTTGAAGGG TCAGTTGAAA ATTTCTTTGC  TGAGTTTGCA ACCTCCATCG AGAAAATGGG AAGAATTAAT GTGAAGACAG GCACAGAAGG AGAGATCAGG AAGCATTGTG CATTTATAAA TAGCTAAGAA TCTTGTCTTG TTCATGGATG  AATCTTGTAT CATTTATTTT TTGGGGTTTG ATTATTTATG CTATGCCATG TTTTTTGATT AGTTATGCTA TGCCATGTGG TCTCTGTCTA CATACGTGTG ATCCTTTATG GTATGGTTGT  TGTATGTGTG TTGGAATAAG TGGGCTCTTA AGTTATTCAT ATTTCCAACT TTCCAACTTT GCTGGTAGAT CATGCTCTTG TAATAAGAAC CAGAATTTTT TGTGCTACCC ACAGCTGAGT 
TAATTTA 

Retrieve as FASTA