Entry information : PtGPx01 (POPTR_0006s28120 / Potri.006G265400)
Entry ID 2889
Creation 2006-03-20 (Felipe Teixeira)
Last sequence changes 2010-07-08 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtGPx01 (POPTR_0006s28120 / Potri.006G265400)
Name (synonym) PtGPx01 (POPTR_0006s28120 / Potri.006G265400)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtGPx01
start..stop
S start..stop
LuGPx140 360 6e-128 2..232 3..244
LuGPx211 360 6e-128 1..232 18..241
VvGPx01 358 3e-127 1..232 1..246
CsGPx01 356 3e-126 29..232 42..245
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26790563..26790805 243 N° 2 26791199..26791275 77 N° 3 26791463..26791524 62 N° 4 26792185..26792303 119
N° 5 26792387..26792554 168 N° 6 26792735..26792764 30  
join(26790563..26790805,26791199..26791275,26791463..26791524,26792185..26792303 ,26792387..26792554,26792735..26792764)


exon

Literature and cross-references PtGPx01 (POPTR_0006s28120 / Potri.006G265400)
Literature JGI.
DNA ref. Phytozome 12:   Chr06 (26790563..26792764)
EST ref. GenBank:   DT480693
Cluster/Prediction ref. UniGene:   Pth.3670
Omic ref. ePlant:   Potri.006G265400
Protein sequence: PtGPx01 (POPTR_0006s28120 / Potri.006G265400)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   232
PWM (Da):   %s   25294.12  
PI (pH):   %s   10.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLPFSCSSVPGLKIHPNPTKMASFVISIKSSLGPSKSAFLQRGFSLQSPNLPGFASKARSFGVFARAATEKSVHDFTVKDINGKDVALSKFKGKALLIVNVASKCGLTSSNYSELTHIYEKYKTGFEILAFPCNQFGGQEPGSNPEIKQFACTRYKAEFPIFDVDVNGPSTAPVYQFLKSSAGGFLGDLIKWNFEKFLVDKNGKVVERYQPTTSPFQIEKDIQKLLAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTACCTTTCTCCTGTTCATCCGTACCGGGTTTGAAAATCCATCCAAACCCTACAAAAATGGCTTCCTTTGTCATTTCCATCAAGTCCTCACTTGGGCCTTCCAAATCTGCT
TTTTTGCAACGTGGGTTTTCTTTACAGTCTCCAAATCTTCCTGGGTTTGCCTCTAAAGCCCGGTCCTTTGGTGTTTTTGCTAGAGCTGCTACAGAGAAATCTGTTCATGACTTCACTGTT
AAG
GTAGTAGCTCTTTTGATAAAGCTTTTTGTTTTTTTACAGTACTGGTTCAACTGTTCAGTTTATCACCTTTTTGAGTCATGGAAGCTGGGATTTGTTTTGATTTCTCTTGCTTGATTT
AGGAGTTTGGACTTGATTGTTCATGAGGTTGTTAGGTTTCAACTTAGTAGATGTAAAGATAAATCTTTGCTGTTTGAATTGGTAAAAGTTTTGAACTTGAAATGTTTTTGCACTTCTTGG
ACTGGTAGAGTGCATAAGAATCAAGAGCTATGCACTCTGGAATATAGTTTTTGTGGCTGTAAGATTTGAAGATCCTAGATATTGATTCATAATTAGCCCTGAAAATATGAAGATGTAAAG
TGAGGAATAACCTTTTTTTCCATTTACTTGATGCAGGATATTAATGGGAAGGATGTTGCTCTTAGCAAATTTAAGGGGAAAGCTCTCTTGATTGTTAATGTCGCTTCGAAATGGTACTCT
CTCCTTTGAGAATGCTTTATTCTGTGATCTGATTTGTTCTCTCATAGTTGGTTGATTAGCTTGGTTTGTTACGTGTCTTGTATATGAAGAACATATATTTCGAAGTTGTACCAAATTTTT
ATTTATCTACTTTTTTCACGACACTTGAGATCTTATTGGAAGTTTTTGTTCTGACTCCAGTGGTTTGACATCATCAAATTATTCGGAACTCACACACATATACGAGAAGTACAAAACTCA
AG
GTAAGCTAAATTTTTGTGAGGAAAGCATTTTGATTTTTGGCTTTTTAGTGCCTGCAACCTGATTGTTTTGGAAAGAAGTTCTGCTTTTGTAAGCGTAATACCTTTACGATGAGGCTGT
CGATGGAATTGGTGTGATCTTTCGCTCTATTTGATATGTTCTTGCTTTCTTTTGGCACCCAAAGCCTTCACACATCTAAAACAGGTGGCTCAATTTGTATGTGGGAGTGATAGGGGAGTG
GTATTTGAACTACTATTTGAATAGGGAGTTTGTGCCCGTCTCATGCATGTTATATAGATTTTAATTTCTGCTATCCCTAGTTAATGAGCAATCTAATGTTTTGTCATGCACCTGAAGCTC
TTCTGACATTGTATTCGTGTGGTGTCCTGCAACTAGTGGACATTGAAAATCTCCAGGATCATAGCAGGCTTCTATCTTTGTTAAGATTGTAAGAGTAACAATATTGTCAGATCAATAAAT
TTACGGACACCATATCAATATAATGAAGAGAACATCCCTGGGGATATTTCGATATCCACACCATTAAGTAGCATATTTGCATCATCTATTTACTTGATTTGAGAAATTTAAAGCAATAGT
GAAAAGATCTCTCTTTCATTAAATTGATGAAGCTAATCTCTATTATGTAACTTTCATTGCAGGCTTCGAAATTCTGGCTTTTCCTTGCAATCAGTTTGGTGGGCAAGAACCTGGATCAAA
CCCTGAGATTAAACAATTTGCTTGTACCAGGTACAAAGCAGAATTTCCAATATTTGATAAG
GTAAGCGGAATTATTCTCTCCTATTTTTGTAAAATGTCTCTTGGAAAAAGAACAATTTA
ATTACTCAAGGTGTTGCATGACAGGTTGATGTGAATGGACCAAGTACAGCTCCAGTCTACCAGTTTCTGAAATCAAGTGCTGGAGGATTTTTAGGTGATTTGATCAAGTGGAACTTTGAG
AAGTTCTTGGTGGACAAGAATGGCAAGGTTGTGGAGAGATATCAACCAACAACATCACCTTTCCAAATCGAG
GTACACTTCTCTTCTCTTTTCAAGCATTTGGATGTTCTTTGAATTCTT
CTATGCGCCATGACTGATAGGAAGTGGCAACATCTGCTCTTATAAACCATGCCACCTGCATACCAATCCTGTCTTCACATTTCAAGTATCAACCAGCTTTCTTAAAAAATTTCTTCTCTT
TTCCTGTTACAGAAGGACATTCAGAAGCTCCTCGCGGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTACCTTTCTCCTGTTCATCCGTACCGGGTTTGAAAATCCATCCAAACCCTACAAAAATGGCTTCCTTTGTCATTTCCATCAAGTCCTCACTTGGGCCTTCCAAATCTGCT
TTTTTGCAACGTGGGTTTTCTTTACAGTCTCCAAATCTTCCTGGGTTTGCCTCTAAAGCCCGGTCCTTTGGTGTTTTTGCTAGAGCTGCTACAGAGAAATCTGTTCATGACTTCACTGTT
AAG
GATATTAATGGGAAGGATGTTGCTCTTAGCAAATTTAAGGGGAAAGCTCTCTTGATTGTTAATGTCGCTTCGAAATGTGGTTTGACATCATCAAATTATTCGGAACTCACACACATA
TACGAGAAGTACAAAACTCAAG
GCTTCGAAATTCTGGCTTTTCCTTGCAATCAGTTTGGTGGGCAAGAACCTGGATCAAACCCTGAGATTAAACAATTTGCTTGTACCAGGTACAAAGCA
GAATTTCCAATATTTGATAAG
GTTGATGTGAATGGACCAAGTACAGCTCCAGTCTACCAGTTTCTGAAATCAAGTGCTGGAGGATTTTTAGGTGATTTGATCAAGTGGAACTTTGAGAAG
TTCTTGGTGGACAAGAATGGCAAGGTTGTGGAGAGATATCAACCAACAACATCACCTTTCCAAATCGAG
AAGGACATTCAGAAGCTCCTCGCGGCATGA

Retrieve as FASTA